NovoPro
Cart 2
  • SLC29A1 Human  cDNA/ORF Clone

SLC29A1 Human cDNA/ORF Clone

Cat.#: 719136-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 248.4 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    solute carrier family 29 member 1 (Augustine blood group)
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    SLC29A1
  • Gene Type
    protein coding
  • Also Known as
    ENT1
  • Encoded Protein Alias
    equilibrative nitrobenzylmercaptopurine riboside (NBMPR)-sensitive nucleoside transporter; nucleoside transporter, es-type; solute carrier family 29 (equilibrative nucleoside transporter), member 1; solute carrier family 29 (nucleoside transporters), member 1
  • Product Name
    SLC29A1(NM_001304465) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens solute carrier family 29 member 1 (Augustine blood group) (SLC29A1), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    1449
  • Annotation
    This variant (4) differs in the 5' UTR and uses an upstream in-frame start codon, compared to variant 1. The encoded isoform (3) has a longer and distinct N-terminus compared to isoform 1.
  • siRNA

    GAGACCAAGUUGGACCUCAtt

    GCCUGGAAUUCUACCGCUAtt

    GAUCGUGCUCAUUAAUUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    SLC29A1(NM_001304463) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens solute carrier family 29 member 1 (Augustine blood group) (SLC29A1), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1497
  • Annotation
    This variant (3) differs in the 5' UTR and uses an upstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a longer and distinct N-terminus compared to isoform 1.
  • siRNA

    GAGACCAAGUUGGACCUCAtt

    GCCUGGAAUUCUACCGCUAtt

    GAUCGUGCUCAUUAAUUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    SLC29A1(NM_001304466) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens solute carrier family 29 member 1 (Augustine blood group) (SLC29A1), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    1446
  • Annotation
    This variant (5) differs in the 5' UTR and uses an upstream in-frame start codon, compared to variant 1. The encoded isoform (4) has a longer and distinct N-terminus compared to isoform 1.
  • siRNA

    GAGACCAAGUUGGACCUCAtt

    GCCUGGAAUUCUACCGCUAtt

    GAUCGUGCUCAUUAAUUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    SLC29A1(XM_005248876) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens solute carrier family 29 member 1 (Augustine blood group) (SLC29A1), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1500
  • siRNA

    GAGACCAAGUUGGACCUCAtt

    GCCUGGAAUUCUACCGCUAtt

    GAUCGUGCUCAUUAAUUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    SLC29A1(XM_011514341) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens solute carrier family 29 member 1 (Augustine blood group) (SLC29A1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1611
  • siRNA

    GAGACCAAGUUGGACCUCAtt

    GCCUGGAAUUCUACCGCUAtt

    GAUCGUGCUCAUUAAUUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    SLC29A1(NM_001304462) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens solute carrier family 29 member 1 (Augustine blood group) (SLC29A1), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    1608
  • Annotation
    This variant (6) differs in the 5' UTR and uses an upstream in-frame start codon, compared to variant 1. The encoded isoform (5) has a longer and distinct N-terminus compared to isoform 1.
  • siRNA

    GAGACCAAGUUGGACCUCAtt

    GCCUGGAAUUCUACCGCUAtt

    GAUCGUGCUCAUUAAUUCAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"