Cart 2
  • SLC22A9 Human  cDNA/ORF Clone

SLC22A9 Human cDNA/ORF Clone

Cat.#: 742828-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 166.1 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    solute carrier family 22 member 9
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    SLC22A9
  • Gene Type
    protein coding
  • Also Known as
    OAT4; OAT7; ust3; HOAT4; UST3H
  • Encoded Protein Alias
    organic anion transporter 4; organic anion transporter 7; solute carrier family 22 (organic anion transporter), member 9; solute carrier family 22 (organic anion/cation transporter), member 9
  • Product Name
    SLC22A9(XM_017017159) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens solute carrier family 22 member 9 (SLC22A9), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1338
  • siRNA

    GUGACGCAGUUUUAAGGAAtt

    GCUACAUACCUUCAUUUUAtt

    CAAUGAGCCUCAUAACAAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pCR4-TOPO
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3956
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    None
  • Description
    TOPO Cloning vector with ampicillin resistance in bacteria.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"