Cart 2
  • KMT5A Human  cDNA/ORF Clone

KMT5A Human cDNA/ORF Clone

Cat.#: 701403-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 162.5 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    lysine methyltransferase 5A
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    KMT5A
  • Gene Type
    protein coding
  • Also Known as
    SET8; SET07; SETD8; PR-Set7
  • Encoded Protein Alias
    N-lysine methyltransferase SETD8; H4-K20-HMTase SETD8; H4-K20-specific histone methyltransferase; H4K20-specific histone methyltransferase splice variant Set8b; PR/SET domain containing protein 8; PR/SET domain-containing protein 07; PR/SET07; SET domain-containing protein 8; histone-lysine N-methyltransferase SETD8; lysine N-methyltransferase 5A
  • Product Name
    KMT5A(XM_006719394) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens lysine methyltransferase 5A (KMT5A), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    948
  • siRNA

    GAAUCUACAGGAAACGAGAtt

    GUACCUUUUCCAAACCAAAtt

    CAUGUACUAUUUUCAGUAUtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-untagged
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6223
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Hygromycin
  • Protein Tag
    None
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"