NovoPro
Cart 2
  • SRSF10 Human  cDNA/ORF Clone

SRSF10 Human cDNA/ORF Clone

Cat.#: 709971-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    serine and arginine rich splicing factor 10
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    SRSF10
  • Gene Type
    protein coding
  • Also Known as
    NSSR; TASR; SRp38; TASR1; TASR2; FUSIP1; FUSIP2; SFRS13; SRrp40; SFRS13A; PPP1R149
  • Encoded Protein Alias
    serine/arginine-rich splicing factor 10; 40 kDa SR-repressor protein; FUS interacting protein (serine-arginine rich) 1; FUS-interacting protein (serine-arginine rich) 2; SR splicing factor 10; TLS-associated SR protein; TLS-associated protein TASR; TLS-associated protein with SR repeats; TLS-associated protein with Ser-Arg repeats; TLS-associated serine-arginine protein 1; TLS-associated serine-arginine protein 2; neural-salient SR protein; protein phosphatase 1, regulatory subunit 149; serine-arginine repressor protein (40 kDa); splicing factor SRp38; splicing factor, arginine/serine-rich 13; splicing factor, arginine/serine-rich 13A
  • Product Name
    SRSF10(NM_001191007) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens serine and arginine rich splicing factor 10 (SRSF10), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    549
  • Annotation
    This variant (5) uses an alternate in-frame splice site and lacks an alternate segment in the 3' coding region, which results in a frameshift, compared to variant 2. The encoded isoform (5) has a distinct C-terminus and is shorter than isoform 2.
  • siRNA

    GGAUGUUCGUGAUGCUGAAtt

    GUCUUUUGAUUACAACUAUtt

    UGGUCGUUAUGGUCCUAUAtt

    CGACGACACCAGGUCUGAAtt

    GCGUGAAUUUGGUCGUUAUtt

    UACAUAAUUUGGACAGAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    SRSF10(NM_001191006) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens serine and arginine rich splicing factor 10 (SRSF10), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    522
  • Annotation
    This variant (4) lacks an alternate segment in the 3' coding region, which results in a frameshift, compared to variant 2. The encoded isoform (4) has a distinct C-terminus and is shorter than isoform 2.
  • siRNA

    GGAUGUUCGUGAUGCUGAAtt

    GUCUUUUGAUUACAACUAUtt

    UGGUCGUUAUGGUCCUAUAtt

    CGACGACACCAGGUCUGAAtt

    GCGUGAAUUUGGUCGUUAUtt

    UACAUAAUUUGGACAGAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    SRSF10(NM_001300937) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens serine and arginine rich splicing factor 10 (SRSF10), transcript variant 9, mRNA.
  • Synonyms
  • ORF length
    654
  • Annotation
    This variant (9) lacks an alternate segment in the 3' coding region, which results in a frameshift, compared to variant 2. The encoded isoform (9) has a distinct C-terminus and is shorter than isoform 2.
  • siRNA

    GGAUGUUCGUGAUGCUGAAtt

    GUCUUUUGAUUACAACUAUtt

    UGGUCGUUAUGGUCCUAUAtt

    CGACGACACCAGGUCUGAAtt

    GCGUGAAUUUGGUCGUUAUtt

    UACAUAAUUUGGACAGAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    SRSF10(NM_001191009) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens serine and arginine rich splicing factor 10 (SRSF10), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    498
  • Annotation
    This variant (6) lacks an alternate segment in the 3' coding region, which results in a frameshift, compared to variant 2. The encoded isoform (6) has a distinct C-terminus and is shorter than isoform 2.
  • siRNA

    GGAUGUUCGUGAUGCUGAAtt

    GUCUUUUGAUUACAACUAUtt

    UGGUCGUUAUGGUCCUAUAtt

    CGACGACACCAGGUCUGAAtt

    GCGUGAAUUUGGUCGUUAUtt

    UACAUAAUUUGGACAGAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    SRSF10(NM_001191005) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens serine and arginine rich splicing factor 10 (SRSF10), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    786
  • Annotation
    This variant (3) uses an alternate in-frame splice site, compared to variant 2. The encoded isoform (3) is shorter than isoform 2.
  • siRNA

    GGAUGUUCGUGAUGCUGAAtt

    GUCUUUUGAUUACAACUAUtt

    UGGUCGUUAUGGUCCUAUAtt

    CGACGACACCAGGUCUGAAtt

    GCGUGAAUUUGGUCGUUAUtt

    UACAUAAUUUGGACAGAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    SRSF10(NM_001300936) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens serine and arginine rich splicing factor 10 (SRSF10), transcript variant 8, mRNA.
  • Synonyms
  • ORF length
    519
  • Annotation
    This variant (8) uses an alternate in-frame splice site and lacks an alternate segment in the 3' coding region, which results in a frameshift, compared to variant 2. The encoded isoform (8) has a distinct C-terminus and is shorter than isoform 2.
  • siRNA

    GGAUGUUCGUGAUGCUGAAtt

    GUCUUUUGAUUACAACUAUtt

    UGGUCGUUAUGGUCCUAUAtt

    CGACGACACCAGGUCUGAAtt

    GCGUGAAUUUGGUCGUUAUtt

    UACAUAAUUUGGACAGAAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pOTB7
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    1815
  • Vector Type
    Cloning Vector
  • Promoter
    -
  • Antibiotic Resistance
    Chloramphenicol
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Gateway® or compatible clone with M13 forward and M13 reverse primers. Chloramphenicol resistance in bacteria.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pUC19
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2686
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pUC19 is a small, high-copy number E. coli plasmid cloning vector, of which multiple cloning sites as shown below. The molecule is a small double-stranded circle, 2686 base pairs in length. pUC19 encodes the N-terminal fragment of b-galactosidase (lacZa), which allows for blue/white colony screening (i.e., a-complementation), as well as a pUC origin of replication.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"