NovoPro
Cart 2
  • SRSF10 Ferret  cDNA/ORF Clone

SRSF10 Ferret cDNA/ORF Clone

Cat.#: 700137-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    serine and arginine rich splicing factor 10
  • Organism
    Ferret
  • Entrez Gene ID
  • Gene Symbol
    SRSF10
  • Gene Type
    protein coding
  • Encoded Protein Alias
    serine/arginine-rich splicing factor 10; FUS interacting protein 1
  • Product Name
    SRSF10(NM_001191009) Ferret cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Mustela putorius furo serine/arginine-rich splicing factor 10 (SRSF10), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    498
  • siRNA

    GGAUGUUCGUGAUGCUGAAtt

    GUCUUUUGAUUACAACUAUtt

    UGGUCGUUAUGGUCCUAUAtt

    CGACGACACCAGGUCUGAAtt

    GCGUGAAUUUGGUCGUUAUtt

    UACAUAAUUUGGACAGAAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"