NovoPro
Cart 2
  • SELE Dog  cDNA/ORF Clones

SELE Dog cDNA/ORF Clones

Cat.#: 734165-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 313.7 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    selectin E
  • Organism
    Dog
  • Entrez Gene ID
  • Gene Symbol
    SELE
  • Gene Type
    protein coding
  • Also Known as
    ELAM-1; LECAM2
  • Encoded Protein Alias
    CD62 antigen-like family member E; endothelial leukocyte adhesion molecule 1; leukocyte-endothelial cell adhesion molecule 2; selectin E (endothelial adhesion molecule 1)
  • Product Name
    SELE(F1PQP7) Dog cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Canis lupus familiaris selectin E (SELE), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1851
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"