NovoPro
Cart 2
  • s1pr2 Zebrafish  cDNA/ORF Clone

s1pr2 Zebrafish cDNA/ORF Clone

Cat.#: 740402-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 190.8 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    sphingosine-1-phosphate receptor 2
  • Organism
    Zebrafish
  • Entrez Gene ID
  • Gene Symbol
    s1pr2
  • Gene Type
    protein coding
  • Also Known as
    mil; edg5; s1p2
  • Encoded Protein Alias
    S1P receptor 2; S1P receptor Edg-5; endothelial differentiation, sphingolipid G-protein-coupled receptor, 5; miles apart; sphingosine 1-phosphate receptor Edg-5
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"