Cart 2
  • RPS6KA1 Chicken  cDNA/ORF Clone

RPS6KA1 Chicken cDNA/ORF Clone

Cat.#: 736000-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 387.2 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    ribosomal protein S6 kinase A1
  • Organism
    Chicken
  • Entrez Gene ID
  • Gene Symbol
    RPS6KA1
  • Gene Type
    protein coding
  • Also Known as
    RSK; RPS6KA
  • Encoded Protein Alias
    MAP kinase-activated protein kinase 1; MAPK-activated protein kinase 1; MAPKAP kinase 1; MAPKAPK-1; S6KII-alpha; p90-RSK; ribosomal protein S6 kinase II alpha
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"