NovoPro
Cart 2
  • ROBO2 Human  cDNA/ORF Clone

ROBO2 Human cDNA/ORF Clone

Cat.#: 712124-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 1,042.6 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    roundabout guidance receptor 2
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    ROBO2
  • Gene Type
    protein coding
  • Also Known as
    SAX3
  • Encoded Protein Alias
    roundabout homolog 2
  • Product Name
    ROBO2(XM_011533984) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X12, mRNA.
  • Synonyms
  • ORF length
    4344
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_017007003) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X23, mRNA.
  • Synonyms
  • ORF length
    4206
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_017006998) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X17, mRNA.
  • Synonyms
  • ORF length
    4275
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_017006993) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X11, mRNA.
  • Synonyms
  • ORF length
    4410
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_017007000) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X19, mRNA.
  • Synonyms
  • ORF length
    4263
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_011533985) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X20, mRNA.
  • Synonyms
  • ORF length
    4218
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(NM_001128929) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    4185
  • Annotation
    This variant (1) represents the use of an alternate promoter and has multiple differences compared to variant 4. These differences result in a distinct 5' UTR and the use of an alternate start codon compared to variant 4. The encoded protein (isoform ROBO2a; PMID 16829019) has a distinct N-terminus and is shorter than isoform 4.
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_017006991) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    4491
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_017007001) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X21, mRNA.
  • Synonyms
  • ORF length
    4212
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_017007004) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X24, mRNA.
  • Synonyms
  • ORF length
    4197
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_017006992) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X10, mRNA.
  • Synonyms
  • ORF length
    4470
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_017007006) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X26, mRNA.
  • Synonyms
  • ORF length
    4140
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(NM_001290039) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    4149
  • Annotation
    This variant (3) lacks an alternate in-frame exon in the 3' coding region compared to variant 4. The encoded protein (isoform 3) is shorter than variant 4.
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_017006994) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X13, mRNA.
  • Synonyms
  • ORF length
    4338
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(NM_001290040) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    4332
  • Annotation
    This variant (4) represents the longest transcript and encodes the longest isoform (4).
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_017006988) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    4611
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_011533981) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    4794
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_017007005) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X25, mRNA.
  • Synonyms
  • ORF length
    4191
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_017006990) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    4596
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_017006999) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X18, mRNA.
  • Synonyms
  • ORF length
    4269
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_011533982) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    4674
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_017006997) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X16, mRNA.
  • Synonyms
  • ORF length
    4317
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_017006987) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    4665
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(NM_001290065) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    2358
  • Annotation
    This variant (5) has multiple differences compared to variant 4. These differences result in a distinct 5' UTR and cause translation initiation at a downstream start codon compared to variant 4; the 5'-most initiation codon, as used in variant 4, is associated with a truncated ORF that would render the transcript a candidate for nonsense-mediated decay (NMD). Leaky scanning may allow translation initiation at the downstream AUG resulting in an isoform (5) with a shorter N-terminus compared to isoform 4.
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_017006986) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    4731
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_017007002) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X22, mRNA.
  • Synonyms
  • ORF length
    4209
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_017006989) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    4605
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_011533983) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    4617
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_017006996) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X15, mRNA.
  • Synonyms
  • ORF length
    4323
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ROBO2(XM_017006995) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens roundabout guidance receptor 2 (ROBO2), transcript variant X14, mRNA.
  • Synonyms
  • ORF length
    4329
  • siRNA

    GGAUUUACUUUUCCGGGUAtt

    CGACCUUCUUGACAUAGGAtt

    CCAGCAUUGCCUCAUCGAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-C-EGFP
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6703
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    GFPSpark
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-C-FLAG
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6013
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    FLAG
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-C-mOrange2
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6662
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    OFPSpark
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-untagged
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6223
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Hygromycin
  • Protein Tag
    None
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pUC18c
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2693
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pMD18-T Vector is a high-efficiency TA cloning vector constructed from pUC18, of which the initial multiple cloning sites (MCS) were destroyed. Thus the cDNA should be amplified by PCR with primers containing a restriction site for subclone. Competent cells appropriate for pUC18 are also appropriated for this Vector, e.g. JM109, DH5α, TOP10. The pMD18-T Simple Vector is 2.6kb in size. Selection of the plasmid in E. coli is conferred by the ampicillin resistance gene. The coding sequence was inserted by TA cloning at site 425.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"