NovoPro
Cart 2
  • Rbm10 Mouse  cDNA/ORF Clones

Rbm10 Mouse cDNA/ORF Clones

Cat.#: 702374-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 438.6 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    RNA binding motif protein 10
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Rbm10
  • Gene Type
    protein coding
  • Also Known as
    E430039K10Rik
  • Encoded Protein Alias
    RNA-binding protein 10; RNA-binding motif protein 10
  • Product Name
    Rbm10(XM_006527619) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus RNA binding motif protein 10 (Rbm10), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    2559
  • siRNA
  • DataSheet:
  • Product Name
    Rbm10(NM_001167776) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus RNA binding motif protein 10 (Rbm10), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    2562
  • Annotation
    This variant (3) lacks an in-frame exon in the coding region, compared to variant 1. The encoded isoform (3) is shorter, compared to isoform 1.
  • siRNA

    GCAGUCCCAUGGUGUCCAAtt

    GGACUACCGCUCAUACCCAtt

    GCAUAUCUACAGCCUCUGUtt

  • DataSheet:
  • Product Name
    Rbm10(NM_145627) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus RNA binding motif protein 10 (Rbm10), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2793
  • Annotation
    This variant (1) encodes the longest isoform (1).
  • siRNA

    GCAGUCCCAUGGUGUCCAAtt

    GGACUACCGCUCAUACCCAtt

    GCAUAUCUACAGCCUCUGUtt

  • DataSheet:
  • Product Name
    Rbm10(XM_006527620) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus RNA binding motif protein 10 (Rbm10), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    2310
  • siRNA
  • DataSheet:
  • Product Name
    Rbm10(NM_001167775) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus RNA binding motif protein 10 (Rbm10), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2790
  • Annotation
    This variant (2) differs in the 5' UTR and uses an alternate in-frame splice site in the coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1.
  • siRNA

    GCAGUCCCAUGGUGUCCAAtt

    GGACUACCGCUCAUACCCAtt

    GCAUAUCUACAGCCUCUGUtt

  • DataSheet:
  • Product Name
    Rbm10(XM_006527621) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus RNA binding motif protein 10 (Rbm10), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    2184
  • siRNA
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"