NovoPro
Cart 2
  • Rfc5 Mouse  cDNA/ORF Clone

Rfc5 Mouse cDNA/ORF Clone

Cat.#: 744910-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 174.8 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    replication factor C (activator 1) 5
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Rfc5
  • Gene Type
    protein coding
  • Also Known as
    36kDa; Recc5; 36.5kDa; 2610020K06Rik; 2610209F07Rik
  • Encoded Protein Alias
    A1 36 kDa subunit; RF-C 36 kDa subunit; RFC36; activator 1 36 kDa subunit; activator 1 subunit 5; replication factor C 36 kDa subunit; replication factor C 5; replication factor C, 36 kDa
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"