NovoPro
Cart 2
  • RFC5 Human  cDNA/ORF Clone

RFC5 Human cDNA/ORF Clone

Cat.#: 712426-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 173.8 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    replication factor C subunit 5
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    RFC5
  • Gene Type
    protein coding
  • Also Known as
    RFC36
  • Encoded Protein Alias
    replication factor C subunit 5; A1 36 kDa subunit; RF-C 36 kDa subunit; RFC, 36.5 kD subunit; replication factor C, 36-kDa subunit
  • Product Name
    RFC5(NM_001206801) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens replication factor C subunit 5 (RFC5), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    1014
  • Annotation
    This variant (5) uses an alternate in-frame splice site in the coding region, compared to variant 1. The resulting isoform (4) is shorter than isoform 1.
  • siRNA

    CAUCCUAGCCUGUGCGAAAtt

    CUUCAGUUCGAAUACAUUUtt

    GAAUGCCUUGAGAAGAGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RFC5(NM_001346815) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens replication factor C subunit 5 (RFC5), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    759
  • Annotation
    This variant (6) differs in the 5' UTR, uses an alternate in-frame splice site in the coding region, and intitiates translation at a downstream in-frame start codon, compared to variant 1. The resulting isoform (5) is shorter than isoform 1.
  • siRNA
  • DataSheet:
  • FAQs:
  • Product Name
    RFC5(NM_001130112) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens replication factor C subunit 5 (RFC5), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    768
  • Annotation
    This variant (4) differs in the 5' UTR and uses a downstream in-frame start codon, compared to variant 1. The resulting isoform (3) is shorter at the N-terminus, compared to isoform 1.
  • siRNA

    CAUCCUAGCCUGUGCGAAAtt

    CUUCAGUUCGAAUACAUUUtt

    GAAUGCCUUGAGAAGAGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RFC5(XM_017019779) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens replication factor C subunit 5 (RFC5), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    915
  • siRNA

    CAUCCUAGCCUGUGCGAAAtt

    CUUCAGUUCGAAUACAUUUtt

    GAAUGCCUUGAGAAGAGUAtt

    GCAUAGAGGUAACUUACAUtt

    GUUUGUGCAUAGAGGUAACtt

    UGUGCAUAGAGGUAACUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RFC5(NM_181578) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens replication factor C subunit 5 (RFC5), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    960
  • Annotation
    This variant (3) differs in the 5' UTR and 5' coding region, and uses an alternate start codon, compared to variant 1. The resulting isoform (2) has a distinct and shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same isoform (2).
  • siRNA

    CAUCCUAGCCUGUGCGAAAtt

    CUUCAGUUCGAAUACAUUUtt

    GAAUGCCUUGAGAAGAGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RFC5(NM_007370) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens replication factor C subunit 5 (RFC5), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1023
  • Annotation
    This variant (1) encodes the longest isoform (1).
  • siRNA

    CAUCCUAGCCUGUGCGAAAtt

    CUUCAGUUCGAAUACAUUUtt

    GAAUGCCUUGAGAAGAGUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"