• Gramd1a Rat  cDNA/ORF Clone

Gramd1a Rat cDNA/ORF Clone

Cat.#: 772208-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 415.5 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    GRAM domain containing 1A
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Gramd1a
  • Gene Type
    protein coding
  • Also Known as
    Eg1rvc; RGD1311022
  • Encoded Protein Alias
    GRAM domain containing 1A
  • Product Name
    Gramd1a(XM_006228833) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus GRAM domain containing 1A (Gramd1a), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    2424
  • siRNA

    GAAACUCUUUAGCAAACUUtt

    CCCACAUACAAACAACGUAtt

    UGAAGUCUCUCAUUGAGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Gramd1a(XM_006228834) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus GRAM domain containing 1A (Gramd1a), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    2184
  • siRNA

    GAAACUCUUUAGCAAACUUtt

    CCCACAUACAAACAACGUAtt

    UGAAGUCUCUCAUUGAGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Gramd1a(XM_006228832) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus GRAM domain containing 1A (Gramd1a), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2436
  • siRNA

    GAAACUCUUUAGCAAACUUtt

    CCCACAUACAAACAACGUAtt

    UGAAGUCUCUCAUUGAGAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5494
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"