Cart 2
  • RASGRP1 Human  cDNA/ORF Clone

RASGRP1 Human cDNA/ORF Clone

Cat.#: 749875-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 385.7 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    RAS guanyl releasing protein 1
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    RASGRP1
  • Gene Type
    protein coding
  • Also Known as
    V; RASGRP; hRasGRP1; CALDAG-GEFI; CALDAG-GEFII
  • Encoded Protein Alias
    RAS guanyl nucleotide-releasing protein 1; RAS guanyl releasing protein 1 (calcium and DAG-regulated); calcium and DAG-regulated guanine nucleotide exchange factor II; calcium- and diacylglycerol-regulated guanine nucleotide exchange factor II; guanine nucleotide exchange factor, calcium- and DAG-regulated, Rap1A; ras activator RasGRP
  • Product Name
    RASGRP1(XM_017021860) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens RAS guanyl releasing protein 1 (RASGRP1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2250
  • siRNA

    CGACCAGGAUGGAUACAUUtt

    CCCUAAAGAUCCAACUGAAtt

    CUACGACAAUUACCGGCGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RASGRP1(NM_001306086) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens RAS guanyl releasing protein 1 (RASGRP1), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1794
  • Annotation
    This variant (3) lacks two internal exons one of which results in a frameshift compared to variant 1. The encoded protein (isoform c) is shorter and has a distinct C-terminus compared to isoform a.
  • siRNA

    CGACCAGGAUGGAUACAUUtt

    CCCUAAAGAUCCAACUGAAtt

    CUACGACAAUUACCGGCGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RASGRP1(XM_005254114) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens RAS guanyl releasing protein 1 (RASGRP1), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    2241
  • siRNA

    CGACCAGGAUGGAUACAUUtt

    CCCUAAAGAUCCAACUGAAtt

    CUACGACAAUUACCGGCGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RASGRP1(NM_005739) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens RAS guanyl releasing protein 1 (RASGRP1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2394
  • Annotation
    This variant (1) represents the longer transcript, and encodes the longer isoform (a).
  • siRNA

    CGACCAGGAUGGAUACAUUtt

    CCCUAAAGAUCCAACUGAAtt

    CUACGACAAUUACCGGCGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RASGRP1(NM_001128602) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens RAS guanyl releasing protein 1 (RASGRP1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2289
  • Annotation
    This variant (2), also known as variant A, lacks an in-frame segment of the coding region, compared to variant 1. It encodes a shorter isoform (b), that is missing an internal segment compared to isoform a.
  • siRNA

    CGACCAGGAUGGAUACAUUtt

    CCCUAAAGAUCCAACUGAAtt

    CUACGACAAUUACCGGCGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RASGRP1(XM_011521151) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens RAS guanyl releasing protein 1 (RASGRP1), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1899
  • siRNA

    CGACCAGGAUGGAUACAUUtt

    CCCUAAAGAUCCAACUGAAtt

    CUACGACAAUUACCGGCGAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"