• PKM Human  cDNA/ORF Clone

PKM Human cDNA/ORF Clone

Cat.#: 712543-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 265.8 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    pyruvate kinase, muscle
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    PKM
  • Gene Type
    protein coding
  • Also Known as
    PK3; TCB; OIP3; PKM2; CTHBP; THBP1; HEL-S-30
  • Encoded Protein Alias
    pyruvate kinase PKM; OIP-3; OPA-interacting protein 3; PK, muscle type; cytosolic thyroid hormone-binding protein; epididymis secretory protein Li 30; p58; pyruvate kinase 2/3; pyruvate kinase isozymes M1/M2; pyruvate kinase muscle isozyme; thyroid hormone-binding protein 1; thyroid hormone-binding protein, cytosolic; tumor M2-PK
  • Product Name
    PKM(NM_001206798) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens pyruvate kinase, muscle (PKM), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    1551
  • Annotation
    This variant (6) differs in the 5' UTR and coding sequence, lacks an alternate exon, and has an alternate in-frame coding exon compared to variant 4. The resulting isoform (e) has a shorter and distinct N-terminus, lacks an alternate internal segment, and has a different internal segment compared to isoform c.
  • siRNA

    CAUCAAGAUUAUCAGCAAAtt

    GGAAAGAACAUCAAGAUUAtt

    GCAUUGAGAUUCCUGCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PKM(XM_006720570) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens pyruvate kinase, muscle (PKM), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1818
  • siRNA

    GAUUAAGUCUGGAAUGAAUtt

    CAUCAAGAUUAUCAGCAAAtt

    GGAAAGAACAUCAAGAUUAtt

    GCAUUGAGAUUCCUGCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PKM(XM_005254443) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens pyruvate kinase, muscle (PKM), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1776
  • siRNA

    GAUUAAGUCUGGAAUGAAUtt

    CAUCAAGAUUAUCAGCAAAtt

    GGAAAGAACAUCAAGAUUAtt

    GCAUUGAGAUUCCUGCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PKM(NM_001316318) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens pyruvate kinase, muscle (PKM), transcript variant 8, mRNA.
  • Synonyms
  • ORF length
    1701
  • Annotation
    This variant (8) lacks an alternate in-frame exon in the 5' end of the coding sequence compared to variant 4. The resulting isoform (g) has the same N- and C-termini but is shorter compared to isoform c.
  • siRNA

    GAUUAAGUCUGGAAUGAAUtt

    CAUCAAGAUUAUCAGCAAAtt

    GGAAAGAACAUCAAGAUUAtt

    GCAUUGAGAUUCCUGCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PKM(NM_001206799) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens pyruvate kinase, muscle (PKM), transcript variant 7, mRNA.
  • Synonyms
  • ORF length
    1611
  • Annotation
    This variant (7) differs in the 5' UTR and coding sequence compared to variant 4. The resulting isoform (f) has a shorter and distinct N-terminus compared to isoform c.
  • siRNA

    GAUUAAGUCUGGAAUGAAUtt

    CAUCAAGAUUAUCAGCAAAtt

    GGAAAGAACAUCAAGAUUAtt

    GCAUUGAGAUUCCUGCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PKM(NM_001206796) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens pyruvate kinase, muscle (PKM), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    1818
  • Annotation
    This variant (4) represents the longest transcript and encodes the longest isoform (c).
  • siRNA

    GAUUAAGUCUGGAAUGAAUtt

    CAUCAAGAUUAUCAGCAAAtt

    GGAAAGAACAUCAAGAUUAtt

    GCAUUGAGAUUCCUGCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PKM(NM_182471) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens pyruvate kinase, muscle (PKM), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1596
  • Annotation
    This variant (2) differs in the 5' UTR and coding sequence compared to variant 4. The resulting isoform (b, also called M1) is shorter at the N-terminus compared to isoform c.
  • siRNA

    GAUUAAGUCUGGAAUGAAUtt

    CAUCAAGAUUAUCAGCAAAtt

    GGAAAGAACAUCAAGAUUAtt

    GCAUUGAGAUUCCUGCAGAtt

  • DataSheet:
  • DataSheet:
  • FAQs:
  • Product Name
    PKM(XM_011521670) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens pyruvate kinase, muscle (PKM), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1701
  • siRNA

    GAUUAAGUCUGGAAUGAAUtt

    CAUCAAGAUUAUCAGCAAAtt

    GGAAAGAACAUCAAGAUUAtt

    GCAUUGAGAUUCCUGCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PKM(NM_001206797) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens pyruvate kinase, muscle (PKM), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    1374
  • Annotation
    This variant (5) differs in the 5' UTR and coding sequence, lacks an alternate in-frame segment, and has an alternate in-frame coding exon compared to variant 4. The resulting isoform (d) is shorter at the N-terminus, lacks an alternate internal segment, and has a different internal segment compared to isoform c.
  • siRNA

    CAUCAAGAUUAUCAGCAAAtt

    GGAAAGAACAUCAAGAUUAtt

    GCAUUGAGAUUCCUGCAGAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-C-EGFP
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6703
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    GFPSpark
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-C-FLAG
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6013
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    FLAG
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-C-HA
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6016
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    HA
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-C-His
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6019
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    His
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-C-Myc
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6019
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    Myc
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-C-mOrange2
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6662
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    OFPSpark
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-N-FLAG
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6013
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    FLAG
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-N-HA
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6016
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    HA
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-N-His
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6019
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    His
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-N-Myc
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6019
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    Myc
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-N-mOrange2
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6662
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    OFPSpark
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-untagged
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6223
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Hygromycin
  • Protein Tag
    None
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pUC18c
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2693
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pMD18-T Vector is a high-efficiency TA cloning vector constructed from pUC18, of which the initial multiple cloning sites (MCS) were destroyed. Thus the cDNA should be amplified by PCR with primers containing a restriction site for subclone. Competent cells appropriate for pUC18 are also appropriated for this Vector, e.g. JM109, DH5α, TOP10. The pMD18-T Simple Vector is 2.6kb in size. Selection of the plasmid in E. coli is conferred by the ampicillin resistance gene. The coding sequence was inserted by TA cloning at site 425.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5494
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"