NovoPro
Cart 2
  • PTPN6 Human  cDNA/ORF Clone

PTPN6 Human cDNA/ORF Clone

Cat.#: 712856-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 191.0 USD

Availability: 1 week
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    protein tyrosine phosphatase, non-receptor type 6
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    PTPN6
  • Gene Type
    protein coding
  • Also Known as
    HCP; HCPH; SHP1; SHP-1; HPTP1C; PTP-1C; SHP-1L; SH-PTP1
  • Encoded Protein Alias
    tyrosine-protein phosphatase non-receptor type 6; hematopoietic cell phosphatase; hematopoietic cell protein-tyrosine phosphatase; protein-tyrosine phosphatase 1C; protein-tyrosine phosphatase SHP-1
  • Product Name
    PTPN6(NM_080548) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens protein tyrosine phosphatase, non-receptor type 6 (PTPN6), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1794
  • Annotation
    This variant (2) uses an alternate 5' terminal exon compared to transcript variant 1, resulting in an isoform (2) with a distinct and longer (by 2 aa) N-terminus, compared to isoform 1.
  • siRNA

    CCCAUAUUCGGAUCCAGAAtt

    GAACCGCUACAAGAACAUUtt

    ACCUCUCCCUGACCCUGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PTPN6(XM_006718994) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens protein tyrosine phosphatase, non-receptor type 6 (PTPN6), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1446
  • siRNA

    CCCAUAUUCGGAUCCAGAAtt

    GAACCGCUACAAGAACAUUtt

    ACCUCUCCCUGACCCUGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PTPN6(NM_002831) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens protein tyrosine phosphatase, non-receptor type 6 (PTPN6), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1788
  • Annotation
    This variant (1) represents the predominant transcript and encodes the shortest isoform (1, also known as SHP-1).
  • siRNA

    CCCAUAUUCGGAUCCAGAAtt

    GAACCGCUACAAGAACAUUtt

    ACCUCUCCCUGACCCUGUAtt

  • DataSheet:
  • FAQs:
  • DataSheet:
  • FAQs:
  • Product Name
    PTPN6(NM_080549) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens protein tyrosine phosphatase, non-receptor type 6 (PTPN6), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1875
  • Annotation
    This variant (3) uses an alternate 5' terminal exon, and an alternate acceptor splice site at the penultimate exon, compared to transcript variant 1, resulting in a longer isoform (3, also known as 70 kDa SHP-1L protein) with distinct N_ and C_ termini, compared to isoform 1.
  • siRNA

    CCCAUAUUCGGAUCCAGAAtt

    GAACCGCUACAAGAACAUUtt

    ACCUCUCCCUGACCCUGUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pUC18c
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2693
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pMD18-T Vector is a high-efficiency TA cloning vector constructed from pUC18, of which the initial multiple cloning sites (MCS) were destroyed. Thus the cDNA should be amplified by PCR with primers containing a restriction site for subclone. Competent cells appropriate for pUC18 are also appropriated for this Vector, e.g. JM109, DH5α, TOP10. The pMD18-T Simple Vector is 2.6kb in size. Selection of the plasmid in E. coli is conferred by the ampicillin resistance gene. The coding sequence was inserted by TA cloning at site 425.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"