NovoPro
Cart 2
  • Prmt8 Mouse  cDNA/ORF Clones

Prmt8 Mouse cDNA/ORF Clones

Cat.#: 701328-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 157.9 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    protein arginine N-methyltransferase 8
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Prmt8
  • Gene Type
    protein coding
  • Also Known as
    Hrmt1l3; Hrmt1l4
  • Encoded Protein Alias
    protein arginine N-methyltransferase 8; HMT1 hnRNP methyltransferase-like 3; heterogeneous nuclear ribonucleoprotein methyltransferase-like 4; heterogeneous nuclear ribonucleoprotein methyltransferase-like protein 4; protein arginine N-methyltransferase 4
  • Product Name
    Prmt8(XM_006506352) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein arginine N-methyltransferase 8 (Prmt8), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    921
  • siRNA
  • DataSheet:
  • Vector Name
    pEXP-C-Myc
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6019
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    Myc
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • Antibodies
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"