NovoPro
Cart 2
  • Psap Mouse  cDNA/ORF Clones

Psap Mouse cDNA/ORF Clones

Cat.#: 709222-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 286.4 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    prosaposin
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Psap
  • Gene Type
    protein coding
  • Also Known as
    SGP-1; AI037048
  • Encoded Protein Alias
    prosaposin; snoRNA MBII-198; sulfated glycoprotein 1
  • Product Name
    Psap(NM_001146121) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus prosaposin (Psap), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1671
  • Annotation
    This variant (3) uses an alternate in-frame splice site in the coding region, compared to variant 2, resulting in a shorter protein (isoform C), compared to isoform B.
  • siRNA

    GAACAUAACCUGGAGAAAAtt

    GAACUACGUGGACCAGUAUtt

    GGGAACUUGCUGAAAGAUAtt

  • DataSheet:
  • Product Name
    Psap(NM_001146122) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus prosaposin (Psap), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    1662
  • Annotation
    This variant (4) lacks an exon in the coding region and uses an alternate in-frame splice site, compared to variant 2, resulting in a shorter protein (isoform D), compared to isoform B.
  • siRNA

    GAACAUAACCUGGAGAAAAtt

    GAACUACGUGGACCAGUAUtt

    GGGAACUUGCUGAAAGAUAtt

  • DataSheet:
  • Product Name
    Psap(XM_017313848) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus prosaposin (Psap), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1671
  • siRNA
  • DataSheet:
  • Product Name
    Psap(NM_001146120) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus prosaposin (Psap), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1665
  • Annotation
    This variant (1) lacks an exon in the coding region, compared to variant 2, resulting in a shorter protein (isoform A), compared to isoform B.
  • siRNA

    GAACAUAACCUGGAGAAAAtt

    GAACUACGUGGACCAGUAUtt

    GGGAACUUGCUGAAAGAUAtt

  • DataSheet:
  • Product Name
    Psap(NM_011179) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus prosaposin (Psap), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1674
  • Annotation
    This variant (2) represents the longest transcript and encodes the longest isoform (B).
  • siRNA

    GAACAUAACCUGGAGAAAAtt

    GAACUACGUGGACCAGUAUtt

    GGGAACUUGCUGAAAGAUAtt

  • DataSheet:
  • Product Name
    Psap(NM_001146123) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus prosaposin (Psap), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    1638
  • Annotation
    This variant (5) lacks an exon in the coding region and uses an alternate in-frame splice site, compared to variant 2, resulting in a shorter protein (isoform E), compared to isoform B.
  • siRNA

    GAACAUAACCUGGAGAAAAtt

    GAACUACGUGGACCAGUAUtt

    GGGAACUUGCUGAAAGAUAtt

  • DataSheet:
  • Product Name
    Psap(NM_001146124) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus prosaposin (Psap), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    1656
  • Annotation
    This variant (6) uses an alternate exon for its 5' UTR and start codon and lacks an exon in the 3' coding region, compared to variant 2, resulting in a protein (isoform F) with a novel N-terminus and shorter C-terminus, compared to isoform B.
  • siRNA

    GAACAUAACCUGGAGAAAAtt

    GAACUACGUGGACCAGUAUtt

    GGGAACUUGCUGAAAGAUAtt

  • DataSheet:
  • Product Name
    Psap(XM_017313849) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus prosaposin (Psap), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1668
  • siRNA
  • DataSheet:
  • Vector Name
    pUC19
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2686
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pUC19 is a small, high-copy number E. coli plasmid cloning vector, of which multiple cloning sites as shown below. The molecule is a small double-stranded circle, 2686 base pairs in length. pUC19 encodes the N-terminal fragment of b-galactosidase (lacZa), which allows for blue/white colony screening (i.e., a-complementation), as well as a pUC origin of replication.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"