Cart 2
  • Gm1987 Mouse  cDNA/ORF Clone

Gm1987 Mouse cDNA/ORF Clone

Cat.#: 700104-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 132.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    predicted gene 1987
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Gm1987
  • Gene Type
    protein coding
  • Also Known as
    100038965
  • Encoded Protein Alias
    predicted gene 1987
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"