NovoPro
Cart 2
  • PARL Human  cDNA/ORF Clone

PARL Human cDNA/ORF Clone

Cat.#: 718931-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 152.2 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    presenilin associated rhomboid like
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    PARL
  • Gene Type
    protein coding
  • Also Known as
    PSARL; PSARL1; RHBDS1; PRO2207; PSENIP2
  • Encoded Protein Alias
    mitochondrial intramembrane-cleaving protease PARL; rhomboid 7 homolog 1
  • Product Name
    PARL(NM_001324437) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens presenilin associated rhomboid like (PARL), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    888
  • Annotation
    This variant (4) encodes isoform 4, which may be localized to the mitochondria.
  • siRNA

    GGUUGAACCUCGAAGAUCAtt

    GGACGCAGGUUUAACUUCUtt

    GGCAUGAAAUAAGGACUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PARL(NM_001037639) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens presenilin associated rhomboid like (PARL), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    990
  • Annotation
    This variant (2) lacks an exon in the coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. The encoded isoform (2) may be localized to the mitochondria.
  • siRNA

    GGUUGAACCUCGAAGAUCAtt

    GGACGCAGGUUUAACUUCUtt

    GGCAUGAAAUAAGGACUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PARL(NM_001324436) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens presenilin associated rhomboid like (PARL), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1038
  • Annotation
    This variant (3) encodes isoform 3, which may be localized to the mitochondria.
  • siRNA

    GGUUGAACCUCGAAGAUCAtt

    GGACGCAGGUUUAACUUCUtt

    GGCAUGAAAUAAGGACUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PARL(NM_001324438) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens presenilin associated rhomboid like (PARL), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    852
  • Annotation
    This variant (5) encodes isoform 5, which is localized to the mitochondria.
  • siRNA

    GGUUGAACCUCGAAGAUCAtt

    GGACGCAGGUUUAACUUCUtt

    GGCAUGAAAUAAGGACUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PARL(NM_018622) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens presenilin associated rhomboid like (PARL), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1140
  • Annotation
    This variant (1) encodes the longest isoform (1), which is localized to the mitochondria.
  • siRNA

    GGUUGAACCUCGAAGAUCAtt

    GGACGCAGGUUUAACUUCUtt

    GGCAUGAAAUAAGGACUAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"