• NUPR1 Human  cDNA/ORF Clone

NUPR1 Human cDNA/ORF Clone

Cat.#: 707479-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    nuclear protein 1, transcriptional regulator
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    NUPR1
  • Gene Type
    protein coding
  • Also Known as
    P8; COM1
  • Encoded Protein Alias
    nuclear protein 1; candidate of metastasis 1; protein p8
  • Product Name
    NUPR1(NM_012385) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens nuclear protein 1, transcriptional regulator (NUPR1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    249
  • Annotation
    This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform b), compared to isoform a.
  • siRNA

    CCCUAGCAAAAGUGCAAGAtt

    CAGCAACAAUAAAUAGACAtt

    CCGCUGACUGAGUCUCUGAtt

  • DataSheet:
  • DataSheet:
  • DataSheet:
  • FAQs:
  • Product Name
    NUPR1(NM_001042483) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens nuclear protein 1, transcriptional regulator (NUPR1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    303
  • Annotation
    This variant (1) encodes the longer isoform (a).
  • siRNA

    CCCUAGCAAAAGUGCAAGAtt

    CAGCAACAAUAAAUAGACAtt

    CCGCUGACUGAGUCUCUGAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pOTB7
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    1815
  • Vector Type
    Cloning Vector
  • Promoter
    -
  • Antibiotic Resistance
    Chloramphenicol
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Gateway® or compatible clone with M13 forward and M13 reverse primers. Chloramphenicol resistance in bacteria.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5494
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"