• NRP2 Human  cDNA/ORF Clone

NRP2 Human cDNA/ORF Clone

Cat.#: 748407-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 439.1 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    neuropilin 2
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    NRP2
  • Gene Type
    protein coding
  • Also Known as
    NP2; NPN2; PRO2714; VEGF165R2
  • Encoded Protein Alias
    neuropilin-2a(17); neuropilin-2a(22); neuropilin-2b(0); receptor for VEGF165 and semaphorins class3; vascular endothelial cell growth factor 165 receptor 2
  • Product Name
    NRP2(NM_201279) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens neuropilin 2 (NRP2), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    2730
  • Annotation
    This variant (3), also known as NRP2a(0), lacks an in-frame segment and a following in-frame exon in the coding region, compared to variant 1. This results in a shorter isoform (3), compared to isoform 1.
  • siRNA

    AGAUUGUCCUCAACUUCAAtt

    CAAGUACUGUGGGACCAAAtt

    GAGCAUUUGUGCGCAAGUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    NRP2(NM_201264) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens neuropilin 2 (NRP2), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    1668
  • Annotation
    This variant (6), also known as S9NRP2b, lacks several 3' exons and uses an alternate segment in the 3' coding region and 3' UTR, compared to variant 1. This results in a shorter, potentially soluble isoform (6) with a distinct C-terminus, compared to isoform 1.
  • siRNA

    AGAUUGUCCUCAACUUCAAtt

    CAAGUACUGUGGGACCAAAtt

    GAGCAUUUGUGCGCAAGUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    NRP2(NM_201267) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens neuropilin 2 (NRP2), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    2706
  • Annotation
    This variant (5), also known as NRP2b(0), includes an alternate 3' sequence, compared to variant 1. This results in a shorter isoform (5) with a distinct C-terminus, compared to isoform 1.
  • siRNA

    AGAUUGUCCUCAACUUCAAtt

    CAAGUACUGUGGGACCAAAtt

    GAGCAUUUGUGCGCAAGUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    NRP2(NM_018534) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens neuropilin 2 (NRP2), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    2721
  • Annotation
    This variant (4), also known as NRP2b(5), lacks the last two 3' exons and includes an alternate 3' exon, compared to variant 1. This results in a shorter isoform (4) with a distinct C-terminus, compared to isoform 1.
  • siRNA

    AGAUUGUCCUCAACUUCAAtt

    CAAGUACUGUGGGACCAAAtt

    GAGCAUUUGUGCGCAAGUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    NRP2(NM_003872) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens neuropilin 2 (NRP2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2781
  • Annotation
    This variant (2), also known as NRP2a(17), lacks an alternate in-frame segment, compared to variant 1. This results in a shorter isoform (2), compared to isoform 1.
  • siRNA

    AGAUUGUCCUCAACUUCAAtt

    CAAGUACUGUGGGACCAAAtt

    GAGCAUUUGUGCGCAAGUUtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pCR4-TOPO
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3956
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    None
  • Description
    TOPO Cloning vector with ampicillin resistance in bacteria.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5494
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"