Cart 2
  • NPR1 Saccharomyces cerevisiae S288c  cDNA/ORF Clone

NPR1 Saccharomyces cerevisiae S288c cDNA/ORF Clone

Cat.#: 726751-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 406.7 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    serine/threonine protein kinase NPR1
  • Organism
    Saccharomyces cerevisiae S288c
  • Entrez Gene ID
  • Gene Symbol
    NPR1
  • Gene Type
    protein coding
  • Encoded Protein Alias
    serine/threonine protein kinase NPR1
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"