NovoPro
Cart 2
  • NOS2 Human  cDNA/ORF Clones

NOS2 Human cDNA/ORF Clones

Cat.#: 712815-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 250.0 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    nitric oxide synthase 2
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    NOS2
  • Gene Type
    protein coding
  • Also Known as
    NOS; INOS; NOS2A; HEP-NOS
  • Encoded Protein Alias
    nitric oxide synthase, inducible; NOS type II; NOS, type II; hepatocyte NOS; inducible NO synthase; inducible NOS; nitric oxide synthase 2A (inducible, hepatocytes); nitric oxide synthase, macrophage; peptidyl-cysteine S-nitrosylase NOS2
  • Vector Name
    pCR4-TOPO
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3956
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    None
  • Description
    TOPO Cloning vector with ampicillin resistance in bacteria.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"