• NET1 Human  cDNA/ORF Clone

NET1 Human cDNA/ORF Clone

Cat.#: 710660-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 214.7 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    neuroepithelial cell transforming 1
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    NET1
  • Gene Type
    protein coding
  • Also Known as
    NET1A; ARHGEF8
  • Encoded Protein Alias
    neuroepithelial cell-transforming gene 1 protein; Rho guanine nucleotide exchange factor (GEF) 8; guanine nucleotide regulatory protein (oncogene); neuroepithelioma transforming gene 1; p65 Net1 proto-oncogene protein; small GTP-binding protein regulator
  • Product Name
    NET1(NM_001047160) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens neuroepithelial cell transforming 1 (NET1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1791
  • Annotation
    This variant (1) represents the longest transcript and encodes the longer isoform (1).
  • siRNA

    GCCCAGAAGUUUUCUAGCAtt

    GGAACGAACGGCACUCUUAtt

    GAAGUCGCCUAGUCAAAUAtt

  • DataSheet:
  • DataSheet:
  • FAQs:
  • Product Name
    NET1(NM_005863) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens neuroepithelial cell transforming 1 (NET1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1629
  • Annotation
    This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1.
  • siRNA

    GCCCAGAAGUUUUCUAGCAtt

    GGAACGAACGGCACUCUUAtt

    GAAGUCGCCUAGUCAAAUAtt

  • DataSheet:
  • DataSheet:
  • DataSheet:
  • FAQs:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"