• Ndrg2 Rat  cDNA/ORF Clone

Ndrg2 Rat cDNA/ORF Clone

Cat.#: 702835-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 140.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    NDRG family member 2
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Ndrg2
  • Gene Type
    protein coding
  • Encoded Protein Alias
    protein NDRG2; N-myc downstream regulated gene 2; N-myc downstream-regulated gene 2 protein; NDRG1-related protein; antidepressant-related protein ADRG123
  • Product Name
    Ndrg2(NM_133583) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus NDRG family member 2 (Ndrg2), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    1074
  • Annotation
    This variant (4) differs in the 5' UTR and lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. Variants 2 and 4 both encode the same isoform (b).
  • siRNA

    CAUACAUUCUGUCACGAUAtt

    CGAUAUUCACCUACCAUGAtt

    GGUGGAAUGUAAUUCAAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Ndrg2(NM_001270863) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus NDRG family member 2 (Ndrg2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1116
  • Annotation
    This variant (1) represents the longest transcript and encodes the longer isoform (a). Variants 1 and 3 both encode the same isoform (a).
  • siRNA

    CAUACAUUCUGUCACGAUAtt

    CGAUAUUCACCUACCAUGAtt

    GGUGGAAUGUAAUUCAAAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pUC19
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2686
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pUC19 is a small, high-copy number E. coli plasmid cloning vector, of which multiple cloning sites as shown below. The molecule is a small double-stranded circle, 2686 base pairs in length. pUC19 encodes the N-terminal fragment of b-galactosidase (lacZa), which allows for blue/white colony screening (i.e., a-complementation), as well as a pUC origin of replication.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5494
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"