Cart 2
  • NPR1 Human  cDNA/ORF Clone

NPR1 Human cDNA/ORF Clone

Cat.#: 712538-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 362.5 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    natriuretic peptide receptor 1
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    NPR1
  • Gene Type
    protein coding
  • Also Known as
    ANPa; NPRA; ANPRA; GUC2A; GUCY2A
  • Encoded Protein Alias
    atrial natriuretic peptide receptor 1; ANP-A; ANPR-A; GC-A; NPR-A; atrial natriuretic peptide receptor type A; atrionatriuretic peptide receptor A; guanylate cyclase A; natriuretic peptide A type receptor; natriuretic peptide receptor A; natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A)
  • Product Name
    NPR1(XM_017001374) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens natriuretic peptide receptor 1 (NPR1), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    2115
  • siRNA

    CAGCGGAUGUGGAACCGAAtt

    CCUUCAGGGUUGUACUGAAtt

    GGUACUCACUCACCAAUGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    NPR1(XM_005245218) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens natriuretic peptide receptor 1 (NPR1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    3108
  • siRNA

    CAGCGGAUGUGGAACCGAAtt

    CCUUCAGGGUUGUACUGAAtt

    GGUACUCACUCACCAAUGAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"