Cart 2
  • NOX4 Human  cDNA/ORF Clone

NOX4 Human cDNA/ORF Clone

Cat.#: 707283-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 285.4 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    NADPH oxidase 4
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    NOX4
  • Gene Type
    protein coding
  • Also Known as
    KOX; KOX-1; RENOX
  • Encoded Protein Alias
    NADPH oxidase 4; kidney oxidase-1; kidney superoxide-producing NADPH oxidase; renal NAD(P)H-oxidase
  • Product Name
    NOX4(XM_011542857) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens NADPH oxidase 4 (NOX4), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1665
  • siRNA

    CAACUCAUAUGGGACAAGAtt

    CAAUAAGAGUUUCUAACUAtt

    GCAAGACCUGGUCAGUAUAtt

    CAGUGUAUCUGCAUUAGAAtt

    GUAUGUUGCAUAACAAGUUtt

    CUCUGUAUGUUGCAUAACAtt

  • DataSheet:
  • FAQs:
  • Product Name
    NOX4(XM_017017842) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens NADPH oxidase 4 (NOX4), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    1266
  • siRNA

    CAACUCAUAUGGGACAAGAtt

    CAAUAAGAGUUUCUAACUAtt

    GCAAGACCUGGUCAGUAUAtt

    CAGUGUAUCUGCAUUAGAAtt

    GUAUGUUGCAUAACAAGUUtt

    CUCUGUAUGUUGCAUAACAtt

  • DataSheet:
  • FAQs:
  • Product Name
    NOX4(NM_001143837) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens NADPH oxidase 4 (NOX4), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1665
  • Annotation
    This variant (3) differs in the 5' UTR and coding region compared to variant 1. These differences cause translation initiation at a downstream AUG and result in a protein (isoform c) with a shorter N-terminus compared to isoform a.
  • siRNA

    CAACUCAUAUGGGACAAGAtt

    CAAUAAGAGUUUCUAACUAtt

    GCAAGACCUGGUCAGUAUAtt

    CAGUGUAUCUGCAUUAGAAtt

    GUAUGUUGCAUAACAAGUUtt

    CUCUGUAUGUUGCAUAACAtt

  • DataSheet:
  • FAQs:
  • Product Name
    NOX4(NM_001291926) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens NADPH oxidase 4 (NOX4), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    1515
  • Annotation
    This variant (4) differs in its 5' UTR, and uses a downstream start codon, compared to variant 1. The encoded isoform (d) has a shorter N-terminus, compared to isoform a.
  • siRNA

    CAACUCAUAUGGGACAAGAtt

    CAAUAAGAGUUUCUAACUAtt

    GCAAGACCUGGUCAGUAUAtt

    CAGUGUAUCUGCAUUAGAAtt

    GUAUGUUGCAUAACAAGUUtt

    CUCUGUAUGUUGCAUAACAtt

  • DataSheet:
  • FAQs:
  • Product Name
    NOX4(NM_001300995) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens NADPH oxidase 4 (NOX4), transcript variant 8, mRNA.
  • Synonyms
  • ORF length
    1545
  • Annotation
    This variant (8) differs in the 5' UTR and coding sequence and lacks an alternate in-frame exon compared to variant 1. The resulting isoform (g) is shorter at the N-terminus and lacks an alternate internal segment compared to isoform a.
  • siRNA

    CAACUCAUAUGGGACAAGAtt

    CAAUAAGAGUUUCUAACUAtt

    GCAAGACCUGGUCAGUAUAtt

    CAGUGUAUCUGCAUUAGAAtt

    GUAUGUUGCAUAACAAGUUtt

    CUCUGUAUGUUGCAUAACAtt

  • DataSheet:
  • FAQs:
  • Product Name
    NOX4(XM_017017841) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens NADPH oxidase 4 (NOX4), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1719
  • siRNA

    CAACUCAUAUGGGACAAGAtt

    GCAAGACCUGGUCAGUAUAtt

    CAGUGUAUCUGCAUUAGAAtt

    GUAUGUUGCAUAACAAGUUtt

    CUCUGUAUGUUGCAUAACAtt

  • DataSheet:
  • FAQs:
  • Product Name
    NOX4(NM_001291929) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens NADPH oxidase 4 (NOX4), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    1662
  • Annotation
    This variant (6) differs in the 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (f) has a shorter and distinct N-terminus, compared to isoform a.
  • siRNA

    CAACUCAUAUGGGACAAGAtt

    CAAUAAGAGUUUCUAACUAtt

    GCAAGACCUGGUCAGUAUAtt

    CAGUGUAUCUGCAUUAGAAtt

    GUAUGUUGCAUAACAAGUUtt

    CUCUGUAUGUUGCAUAACAtt

  • DataSheet:
  • FAQs:
  • Product Name
    NOX4(XM_017017844) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens NADPH oxidase 4 (NOX4), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    1239
  • siRNA

    CAACUCAUAUGGGACAAGAtt

    CAAUAAGAGUUUCUAACUAtt

    GCAAGACCUGGUCAGUAUAtt

    CAGUGUAUCUGCAUUAGAAtt

    GUAUGUUGCAUAACAAGUUtt

    CUCUGUAUGUUGCAUAACAtt

  • DataSheet:
  • FAQs:
  • Product Name
    NOX4(XM_006718849) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens NADPH oxidase 4 (NOX4), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1680
  • siRNA

    CAACUCAUAUGGGACAAGAtt

    CAAUAAGAGUUUCUAACUAtt

    GCAAGACCUGGUCAGUAUAtt

    CAGUGUAUCUGCAUUAGAAtt

    GUAUGUUGCAUAACAAGUUtt

    CUCUGUAUGUUGCAUAACAtt

  • DataSheet:
  • FAQs:
  • Product Name
    NOX4(NM_001291927) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens NADPH oxidase 4 (NOX4), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    1800
  • Annotation
    This variant (5) differs in the 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (e) has a longer and distinct N-terminus, compared to isoform a.
  • siRNA

    CAACUCAUAUGGGACAAGAtt

    CAAUAAGAGUUUCUAACUAtt

    GCAAGACCUGGUCAGUAUAtt

    CAGUGUAUCUGCAUUAGAAtt

    GUAUGUUGCAUAACAAGUUtt

    CUCUGUAUGUUGCAUAACAtt

  • DataSheet:
  • FAQs:
  • Product Name
    NOX4(NM_001143836) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens NADPH oxidase 4 (NOX4), transcript variant NOX4B, mRNA.
  • Synonyms
  • ORF length
    1617
  • Annotation
    This variant (NOX4B), lacks an exon in the coding region compared to variant 1. The encoded isoform (b) is shorter compared to isoform a.
  • siRNA

    CAACUCAUAUGGGACAAGAtt

    CAAUAAGAGUUUCUAACUAtt

    GCAAGACCUGGUCAGUAUAtt

    CAGUGUAUCUGCAUUAGAAtt

    GUAUGUUGCAUAACAAGUUtt

    CUCUGUAUGUUGCAUAACAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pEXP-C-EGFP
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6703
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    GFPSpark
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-C-FLAG
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6013
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    FLAG
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-C-mOrange2
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6662
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    OFPSpark
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-N-EGFP
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6703
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    GFPSpark
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-N-FLAG
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6013
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    FLAG
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-N-His
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6019
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    His
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-untagged
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6223
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Hygromycin
  • Protein Tag
    None
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"