NovoPro
Cart 2
  • MRPL34 Cattle  cDNA/ORF Clone

MRPL34 Cattle cDNA/ORF Clone

Cat.#: 729455-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 5-8 days
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    mitochondrial ribosomal protein L34
  • Organism
    Cattle
  • Entrez Gene ID
  • Gene Symbol
    MRPL34
  • Gene Type
    protein coding
  • Also Known as
    L34mt; MRP-L34
  • Encoded Protein Alias
    39S ribosomal protein L34, mitochondrial; L34mt; MRP-L34
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"