NovoPro
Cart 2
  • Ptpn13 Mouse  cDNA/ORF Clone

Ptpn13 Mouse cDNA/ORF Clone

Cat.#: 750976-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    protein tyrosine phosphatase, non-receptor type 13
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Ptpn13
  • Gene Type
    protein coding
  • Also Known as
    RIP; PTPL1; Ptpri; PTP-BL; AI324989
  • Product Name
    Ptpn13(NM_011204) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus protein tyrosine phosphatase, non-receptor type 13 (Ptpn13), mRNA.
  • Synonyms
  • ORF length
    7356
  • siRNA

    CGUUGUUUUUCCGAAUUAAtt

    CAUCCAUUAUGUGAACGGAtt

    CGUCAGAUGGAAUCAAGCAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"