Cart 2
  • Pml Mouse  cDNA/ORF Clone

Pml Mouse cDNA/ORF Clone

Cat.#: 754398-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 485.4 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    promyelocytic leukemia
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Pml
  • Gene Type
    protein coding
  • Also Known as
    Trim19; AI661194; 1200009E24Rik
  • Product Name
    Pml(NM_178087) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus promyelocytic leukemia (Pml), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2658
  • Annotation
    This variant (2) represents the longest transcript and it encodes the longest protein (isoform 2).
  • siRNA

    AGUACGCGCAAGUCCAAUAtt

    CGAUAUUGGUGAGGAGAUUtt

    AGACCCUGAGUGAUAUUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Pml(NM_001311088) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus promyelocytic leukemia (Pml), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1899
  • Annotation
    This variant (3) uses an alternate splice site in the 3' coding region that results in a frame-shift compared to variant 2. It encodes isoform 3, which is shorter than and has a distinct C-terminus compared to isoform 2.
  • siRNA
  • DataSheet:
  • FAQs:
  • Product Name
    Pml(NM_008884) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus promyelocytic leukemia (Pml), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2520
  • Annotation
    This variant (1) lacks an alternate in-frame segment in the CDS, compared to variant 2. The resulting protein (isoform 1) is shorter than isoform 2.
  • siRNA

    AGUACGCGCAAGUCCAAUAtt

    CGAUAUUGGUGAGGAGAUUtt

    AGACCCUGAGUGAUAUUAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"