• Eftud2 Mouse  cDNA/ORF Clone

Eftud2 Mouse cDNA/ORF Clone

Cat.#: 768760-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 515.1 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    elongation factor Tu GTP binding domain containing 2
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Eftud2
  • Gene Type
    protein coding
  • Also Known as
    116kDa; Snrp116; U5-116kD
  • Encoded Protein Alias
    elongation factor Tu GTP binding domain containing 2
  • Product Name
    Eftud2(NM_001109995) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus elongation factor Tu GTP binding domain containing 2 (Eftud2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2919
  • Annotation
    This variant (2) represents the longer transcript and encodes the longer protein (isoform b).
  • siRNA

    GACGAGAACCUGAUCCUUUtt

    GCGAUGAAUUGAUUCGGAAtt

    CUUCAAUCCUAAGACGAGAtt

  • DataSheet:
  • DataSheet:
  • FAQs:
  • Product Name
    Eftud2(NM_011431) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus elongation factor Tu GTP binding domain containing 2 (Eftud2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2916
  • Annotation
    This variant (1) uses an alternate splice site in the 5' coding region compared to variant 2. The resulting protein (isoform a) is shorter but has the same N- and C-termini compared to isoform b.
  • siRNA

    GACGAGAACCUGAUCCUUUtt

    GCGAUGAAUUGAUUCGGAAtt

    CUUCAAUCCUAAGACGAGAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5494
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"