NovoPro
Cart 2
  • Chd5 Mouse  cDNA/ORF Clone

Chd5 Mouse cDNA/ORF Clone

Cat.#: 751232-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    chromodomain helicase DNA binding protein 5
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Chd5
  • Gene Type
    protein coding
  • Also Known as
    CHD-5; AW060752; 4930532L22Rik; B230399N07Rik
  • Product Name
    Chd5(NM_029216) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus chromodomain helicase DNA binding protein 5 (Chd5), transcript variant 2, mRNA.
  • Synonyms
    XM_196334  
  • ORF length
    5748
  • Annotation
    This variant (2) lacks an in-frame exon, compared to variant 1. It encodes isoform 2 which is shorter than isoform 1.
  • siRNA

    GCUCUUCUGUGCGUUCUGAtt

    GGCCUUAACUGGUUACGCUtt

    CAAGGAAGAUCAGAUCAAAtt

    GAGUAGAGGGUGAAGACAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Chd5(NM_001081376) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus chromodomain helicase DNA binding protein 5 (Chd5), transcript variant 1, mRNA.
  • Synonyms
    XM_902432  
  • ORF length
    5859
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (1).
  • siRNA

    GCUCUUCUGUGCGUUCUGAtt

    CACCCAUCCCUGACAUACAtt

    GGCCUUAACUGGUUACGCUtt

    CAAGGAAGAUCAGAUCAAAtt

    GAGUAGAGGGUGAAGACAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"