NovoPro
Cart 2
  • Abca3 Mouse  cDNA/ORF Clone

Abca3 Mouse cDNA/ORF Clone

Cat.#: 752054-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    ATP-binding cassette, sub-family A (ABC1), member 3
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Abca3
  • Gene Type
    protein coding
  • Also Known as
    Abc3; ABC-C; 1810036E22Rik
  • Product Name
    Abca3(NM_013855) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus ATP-binding cassette, sub-family A (ABC1), member 3 (Abca3), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    5115
  • Annotation
    This variant (2) lacks an internal exon in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein.
  • siRNA

    CGAACAUCUUUACUUCUAUtt

    CGAGUAUGGUAGAACGGUUtt

    GCUCAUAGGAAAAUUCGAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"