• A2m Mouse  cDNA/ORF Clone

A2m Mouse cDNA/ORF Clone

Cat.#: 756996-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 477.7 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    alpha-2-macroglobulin
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    A2m
  • Gene Type
    protein coding
  • Also Known as
    A2mp
  • Product Name
    A2m(NM_175628) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus alpha-2-macroglobulin (A2m), mRNA.
  • Synonyms
  • ORF length
    4425
  • siRNA

    GAUAUAUCUUCAUCGAUGAtt

    CCGGUAAAGGGCUCACUAAtt

    GCAACCAUGUCUACACUAAtt

    GGAUAUGGGCUUAAAGGUAtt

    GAAGCAAACCAGAACAUAAtt

    GAACAAAAGUCUCACUGCAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5494
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"