NovoPro
Cart 2
  • MLX Human  cDNA/ORF Clone

MLX Human cDNA/ORF Clone

Cat.#: 711755-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 153.7 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    MLX, MAX dimerization protein
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    MLX
  • Gene Type
    protein coding
  • Also Known as
    TF4; MAD7; MXD7; TCFL4; bHLHd13
  • Encoded Protein Alias
    max-like protein X; BigMax protein; MAX-like bHLHZIP protein; class D basic helix-loop-helix protein 13; transcription factor-like protein 4
  • Product Name
    MLX(NM_170607) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens MLX, MAX dimerization protein (MLX), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    897
  • Annotation
    This variant (3) contains two additional segments in the coding region compared to variant 1. The resulting isoform (gamma) thus, is longer than isoform alpha encoded by variant 1.
  • siRNA

    CUAAAGAUCAUGAAAGUGAtt

    CAUUGACUACAUUCAGUUUtt

    CGCCCUAAAGAUCAUGAAAtt

    AGGUGUCCACGUUACGCAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MLX(XM_017024991) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens MLX, MAX dimerization protein (MLX), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    807
  • siRNA

    CUAAAGAUCAUGAAAGUGAtt

    CAUUGACUACAUUCAGUUUtt

    CGCCCUAAAGAUCAUGAAAtt

    AGGUGUCCACGUUACGCAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MLX(NM_198204) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens MLX, MAX dimerization protein (MLX), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    735
  • Annotation
    This variant (2) contains an additional coding exon compared to variant 1. The resulting isoform (beta) thus, is longer than isoform alpha encoded by variant 1.
  • siRNA

    CUAAAGAUCAUGAAAGUGAtt

    CAUUGACUACAUUCAGUUUtt

    CGCCCUAAAGAUCAUGAAAtt

    AGGUGUCCACGUUACGCAAtt

  • DataSheet:
  • FAQs:
  • DataSheet:
  • FAQs:
  • Product Name
    MLX(NM_198205) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens MLX, MAX dimerization protein (MLX), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    645
  • Annotation
    This variant (1) encodes the shortest isoform (alpha).
  • siRNA

    CUAAAGAUCAUGAAAGUGAtt

    CAUUGACUACAUUCAGUUUtt

    CGCCCUAAAGAUCAUGAAAtt

    AGGUGUCCACGUUACGCAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"