Cart 2
  • Mlh1 Mouse  cDNA/ORF Clone

Mlh1 Mouse cDNA/ORF Clone

Cat.#: 749221-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 216.0 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    mutL homolog 1
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Mlh1
  • Gene Type
    protein coding
  • Also Known as
    AI317206; AI325952; AI561766; 1110035C23Rik
  • Encoded Protein Alias
    colon cancer, nonpolyposis type 2; mutL protein homolog 1
  • Product Name
    Mlh1(NM_001324522) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus mutL homolog 1 (Mlh1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1560
  • Annotation
    This variant (2) uses a frame-shifting alternate splice site in the 5' region and uses a downstream start codon, compared to variant 1. It encodes isoform 2 which lacks a large segment of the N-terminus, compared to isoform 1.
  • siRNA
  • DataSheet:
  • FAQs:
  • Product Name
    Mlh1(NM_026810) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus mutL homolog 1 (Mlh1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2283
  • Annotation
    This variant (1) encodes the longer isoform (1).
  • siRNA

    GGCUAUAUAUCGAAUGCAAtt

    GCGACAAGGUCUACGCUUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"