Cart 2
  • MAPT Human  cDNA/ORF Clone

MAPT Human cDNA/ORF Clone

Cat.#: 713144-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 191.0 USD

Availability: 1 week
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    microtubule associated protein tau
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    MAPT
  • Gene Type
    protein coding
  • Also Known as
    TAU; MSTD; PPND; DDPAC; MAPTL; MTBT1; MTBT2; FTDP-17; PPP1R103
  • Encoded Protein Alias
    microtubule-associated protein tau; G protein beta1/gamma2 subunit-interacting factor 1; PHF-tau; microtubule-associated protein tau, isoform 4; neurofibrillary tangle protein; paired helical filament-tau; protein phosphatase 1, regulatory subunit 103
  • Product Name
    MAPT(NM_016834) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens microtubule associated protein tau (MAPT), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1152
  • Annotation
    This variant (3) lacks five internal coding exons, as compared to variant 6. The reading frame is not affected, and the resulting isoform (3) has identical N- and C-termini but lacks four segments, as compared to isoform 6.
  • siRNA

    CAUCCAUCAUAAACCAGGAtt

    AGGUGGAAGUAAAAUCUGAtt

    CAUGGUCAGUAAAAGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MAPT(NM_016835) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens microtubule associated protein tau (MAPT), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2277
  • Annotation
    This variant (1) lacks one internal coding exons, as compared to variant 6. The reading frame is not affected, and the resulting isoform (1) has identical N- and C-termini but lacks one segment, as compared to isoform 6.
  • siRNA

    CAUCCAUCAUAAACCAGGAtt

    AGGUGGAAGUAAAAUCUGAtt

    CAUGGUCAGUAAAAGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MAPT(XM_005257369) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens microtubule associated protein tau (MAPT), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    1524
  • siRNA

    CAUCCAUCAUAAACCAGGAtt

    AGGUGGAAGUAAAAUCUGAtt

    CAUGGUCAGUAAAAGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MAPT(XM_005257365) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens microtubule associated protein tau (MAPT), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    2496
  • siRNA

    CAUCCAUCAUAAACCAGGAtt

    AGGUGGAAGUAAAAUCUGAtt

    CAUGGUCAGUAAAAGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MAPT(NM_001203252) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens microtubule associated protein tau (MAPT), transcript variant 8, mRNA.
  • Synonyms
  • ORF length
    1233
  • Annotation
    This variant (8) lacks three internal coding exons, as compared to variant 6. The reading frame is not affected, and the resulting isoform (8) has identical N- and C-termini but lacks three segments, as compared to isoform 6.
  • siRNA

    CAUCCAUCAUAAACCAGGAtt

    AGGUGGAAGUAAAAUCUGAtt

    CAUGGUCAGUAAAAGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MAPT(XM_005257366) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens microtubule associated protein tau (MAPT), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    2415
  • siRNA

    CAUCCAUCAUAAACCAGGAtt

    AGGUGGAAGUAAAAUCUGAtt

    CAUGGUCAGUAAAAGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MAPT(XM_005257370) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens microtubule associated protein tau (MAPT), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    1437
  • siRNA

    CAUCCAUCAUAAACCAGGAtt

    AGGUGGAAGUAAAAUCUGAtt

    CAUGGUCAGUAAAAGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MAPT(XM_005257368) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens microtubule associated protein tau (MAPT), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    2298
  • siRNA

    CAUCCAUCAUAAACCAGGAtt

    AGGUGGAAGUAAAAUCUGAtt

    CAUGGUCAGUAAAAGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MAPT(NM_001123067) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens microtubule associated protein tau (MAPT), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    1239
  • Annotation
    This variant (5) lacks four internal coding exons, as compared to variant 6. The reading frame is not affected, and the resulting isoform (5) has identical N- and C-termini but lacks four segments, as compared to isoform 6.
  • siRNA

    CAUCCAUCAUAAACCAGGAtt

    AGGUGGAAGUAAAAUCUGAtt

    CAUGGUCAGUAAAAGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MAPT(XM_005257371) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens microtubule associated protein tau (MAPT), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    1350
  • siRNA

    CAUCCAUCAUAAACCAGGAtt

    AGGUGGAAGUAAAAUCUGAtt

    CAUGGUCAGUAAAAGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MAPT(XM_005257362) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens microtubule associated protein tau (MAPT), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2589
  • siRNA

    CAUCCAUCAUAAACCAGGAtt

    AGGUGGAAGUAAAAUCUGAtt

    CAUGGUCAGUAAAAGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MAPT(NM_001123066) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens microtubule associated protein tau (MAPT), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    2331
  • Annotation
    This variant (6) encodes the longest isoform (6).
  • siRNA

    CAUCCAUCAUAAACCAGGAtt

    AGGUGGAAGUAAAAUCUGAtt

    CAUGGUCAGUAAAAGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MAPT(NM_005910) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens microtubule associated protein tau (MAPT), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1326
  • Annotation
    This variant (2) lacks three internal coding exons, as compared to variant 6. The reading frame is not affected, and the resulting isoform (2) has identical N- and C-termini but lacks three segments, as compared to isoform 6.
  • siRNA

    CAUCCAUCAUAAACCAGGAtt

    AGGUGGAAGUAAAAUCUGAtt

    CAUGGUCAGUAAAAGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MAPT(XM_005257364) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens microtubule associated protein tau (MAPT), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    2502
  • siRNA

    CAUCCAUCAUAAACCAGGAtt

    AGGUGGAAGUAAAAUCUGAtt

    CAUGGUCAGUAAAAGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MAPT(XM_005257367) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens microtubule associated protein tau (MAPT), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    2391
  • siRNA

    CAUCCAUCAUAAACCAGGAtt

    AGGUGGAAGUAAAAUCUGAtt

    CAUGGUCAGUAAAAGCAAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-C-EGFP
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6703
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    GFPSpark
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-C-FLAG
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6013
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    FLAG
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-C-mOrange2
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6662
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    OFPSpark
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-N-EGFP
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6703
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    GFPSpark
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-N-FLAG
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6013
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    FLAG
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-untagged
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6223
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Hygromycin
  • Protein Tag
    None
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pUC18c
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2693
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pMD18-T Vector is a high-efficiency TA cloning vector constructed from pUC18, of which the initial multiple cloning sites (MCS) were destroyed. Thus the cDNA should be amplified by PCR with primers containing a restriction site for subclone. Competent cells appropriate for pUC18 are also appropriated for this Vector, e.g. JM109, DH5α, TOP10. The pMD18-T Simple Vector is 2.6kb in size. Selection of the plasmid in E. coli is conferred by the ampicillin resistance gene. The coding sequence was inserted by TA cloning at site 425.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"