NovoPro
Cart 2
  • MTOR Human  cDNA/ORF Clone

MTOR Human cDNA/ORF Clone

Cat.#: 713817-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    mechanistic target of rapamycin
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    MTOR
  • Gene Type
    protein coding
  • Also Known as
    SKS; FRAP; FRAP1; FRAP2; RAFT1; RAPT1
  • Encoded Protein Alias
    serine/threonine-protein kinase mTOR; FK506 binding protein 12-rapamycin associated protein 2; FK506-binding protein 12-rapamycin complex-associated protein 1; FKBP-rapamycin associated protein; FKBP12-rapamycin complex-associated protein 1; mammalian target of rapamycin; rapamycin and FKBP12 target 1; rapamycin associated protein FRAP2; rapamycin target protein 1
  • Product Name
    MTOR(XM_017000901) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens mechanistic target of rapamycin (MTOR), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    6402
  • siRNA

    GCUCGUAGUUGGGAUAACAtt

    CAUUCGCAUUCAGUCCAUAtt

    GGAGCCUUGUUGAUCCUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MTOR(XM_017000900) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens mechanistic target of rapamycin (MTOR), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    6969
  • siRNA

    GCUCGUAGUUGGGAUAACAtt

    CAUUCGCAUUCAGUCCAUAtt

    GGAGCCUUGUUGAUCCUUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-C-mOrange2
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6662
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    OFPSpark
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"