Cart 2
  • Mapt Mouse  cDNA/ORF Clone

Mapt Mouse cDNA/ORF Clone

Cat.#: 749950-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 394.9 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    microtubule-associated protein tau
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Mapt
  • Gene Type
    protein coding
  • Also Known as
    Tau; Mtapt; AI413597; AW045860
  • Encoded Protein Alias
    PHF-tau; neurofibrillary tangle protein; paired helical filament-tau
  • Product Name
    Mapt(NM_001285456) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus microtubule-associated protein tau (Mapt), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    1026
  • Annotation
    This variant (5) lacks two consecutive exons in the 5' coding region and an exon in the 3' coding region, compared to variant 1. The resulting isoform (e) lacks two internal segments, compared to isoform a.
  • siRNA

    GGACAGGAAAUGACGAGAAtt

    CCAAAAUCCGGAGAACGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Mapt(NM_001285455) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus microtubule-associated protein tau (Mapt), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    1053
  • Annotation
    This variant (4) lacks three consecutive exons in the 5' coding region, compared to variant 1. The resulting isoform (d) lacks an internal segment, compared to isoform a.
  • siRNA

    GCAAGGUGCAGAUAAUUAAtt

    GGACAGGAAAUGACGAGAAtt

    CCAAAAUCCGGAGAACGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Mapt(NM_010838) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus microtubule-associated protein tau (Mapt), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1119
  • Annotation
    This variant (2) lacks two consecutive exons in the coding region, compared to variant 1. The resulting isoform (b) lacks an internal segment, compared to isoform a.
  • siRNA

    GCAAGGUGCAGAUAAUUAAtt

    GGACAGGAAAUGACGAGAAtt

    CCAAAAUCCGGAGAACGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Mapt(NM_001038609) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus microtubule-associated protein tau (Mapt), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1293
  • Annotation
    This variant (1) encodes the longest isoform (a).
  • siRNA

    GCAAGGUGCAGAUAAUUAAtt

    GGACAGGAAAUGACGAGAAtt

    CCAAAAUCCGGAGAACGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Mapt(NM_001285454) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus microtubule-associated protein tau (Mapt), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1095
  • Annotation
    This variant (3) has multiple coding region differences and differs in the 3' UTR, compared to variant 1. The resulting isoform (c) lacks two internal segments and has a longer and distinct C-terminus, compared to isoform a.
  • siRNA

    GGACAGGAAAUGACGAGAAtt

    CCAAAAUCCGGAGAACGAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"