Cart 2
  • Map4k2 Mouse  cDNA/ORF Clone

Map4k2 Mouse cDNA/ORF Clone

Cat.#: 746765-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 422.7 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    mitogen-activated protein kinase kinase kinase kinase 2
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Map4k2
  • Gene Type
    protein coding
  • Also Known as
    GCK; BL44; Rab8ip; AI385662
  • Encoded Protein Alias
    MAPK/ERK kinase kinase kinase 2; MEK kinase kinase 2; MEKKK 2; RAB8 interacting protein; germinal center kinase; mitogen activated protein kinase kinase kinase kinase 2; rab8-interacting protein
  • Product Name
    Map4k2(NM_009006) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus mitogen-activated protein kinase kinase kinase kinase 2 (Map4k2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2466
  • Annotation
    This variant (1) encodes the longest isoform (1).
  • siRNA

    CCUUUGACUUCACUAUUGAtt

    CCAAGAUUCCUGACACCAAtt

    GACCGAUUGUGGAUCUGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Map4k2(NM_001291787) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus mitogen-activated protein kinase kinase kinase kinase 2 (Map4k2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2199
  • Annotation
    This variant (2) uses an alternate splice junction at the 5' end of an exon compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1.
  • siRNA

    CCUUUGACUUCACUAUUGAtt

    CCAAGAUUCCUGACACCAAtt

    GACCGAUUGUGGAUCUGUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"