• LRRK1 Human  cDNA/ORF Clone

LRRK1 Human cDNA/ORF Clone

Cat.#: 718804-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 943.9 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    leucine rich repeat kinase 1
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    LRRK1
  • Gene Type
    protein coding
  • Also Known as
    RIPK6; Roco1
  • Encoded Protein Alias
    LRRK1
  • Product Name
    LRRK1(XM_011522016) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens leucine-rich repeat kinase 1 (LRRK1), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    5745
  • siRNA

    GGCCUCGCAUUGUAUAUGAtt

    GCACAUCAACAUCAAGCUAtt

    GACUCAGACAUGCUACAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    LRRK1(XM_017022570) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens leucine-rich repeat kinase 1 (LRRK1), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    4575
  • siRNA

    GGCCUCGCAUUGUAUAUGAtt

    GCACAUCAACAUCAAGCUAtt

    GACUCAGACAUGCUACAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    LRRK1(XM_011522014) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens leucine-rich repeat kinase 1 (LRRK1), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    5946
  • siRNA

    GGCCUCGCAUUGUAUAUGAtt

    GCACAUCAACAUCAAGCUAtt

    GACUCAGACAUGCUACAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    LRRK1(XM_011522015) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens leucine-rich repeat kinase 1 (LRRK1), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    5304
  • siRNA

    GGCCUCGCAUUGUAUAUGAtt

    GCACAUCAACAUCAAGCUAtt

    GACUCAGACAUGCUACAUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5494
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"