Cart 2
  • LILRA3 Human  cDNA/ORF Clone

LILRA3 Human cDNA/ORF Clone

Cat.#: 710107-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 214.7 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    leukocyte immunoglobulin like receptor A3
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    LILRA3
  • Gene Type
    protein coding
  • Also Known as
    HM31; HM43; ILT6; LIR4; CD85E; ILT-6; LIR-4
  • Encoded Protein Alias
    leukocyte immunoglobulin-like receptor subfamily A member 3; CD85 antigen-like family member E; immunoglobulin-like transcript 6; leukocyte immunoglobulin-like receptor 4; leukocyte immunoglobulin-like receptor A3; monocyte inhibitory receptor HM43/HM31
  • Product Name
    LILRA3(NM_001172654) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens leukocyte immunoglobulin like receptor A3 (LILRA3), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1128
  • Annotation
    This variant (2) uses an alternate in-frame splice site in the central coding region, compared to variant 1. The resulting isoform (2) lacks an internal segment, compared to isoform 1.
  • siRNA

    AAAAGAUAAUUAUCCAUGAtt

    CGCUGCGUCUAAAAUCAAAtt

    GCAGGGCGGUAUUGCUGUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"