Cart 2
  • Nox4 Mouse  cDNA/ORF Clone

Nox4 Mouse cDNA/ORF Clone

Cat.#: 717283-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 189.2 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    NADPH oxidase 4
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Nox4
  • Gene Type
    protein coding
  • Also Known as
    AI648021
  • Encoded Protein Alias
    KOX-1; kidney oxidase-1; kidney superoxide-producing NADPH oxidase; renal NAD(P)H-oxidase; superoxide-generating NADPH oxidase 4
  • Product Name
    Nox4(NM_001285835) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus NADPH oxidase 4 (Nox4), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1515
  • Annotation
    This variant (3) uses an alternate splice junction at the 5' end of an exon compared to variant 1. This difference causes translation initiation at a downstream AUG and results in an isoform (3) with a shorter N-terminus compared to isoform 1.
  • siRNA

    GAAAUUACCCUAAGUUAUAtt

    GGAUAAAAGCAAGACUCUAtt

    CAUUUGCAUCGAUACUAAAtt

    CCAAGACUCUUCAUAGUUUtt

    GCUUCUACCUACGCAAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Nox4(NM_001285833) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus NADPH oxidase 4 (Nox4), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1632
  • Annotation
    This variant (2) uses an alternate splice junction at the 5' end of an exon and contains two additional alternate coding exons compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (2) with a shorter N-terminus and an alternate internal segment compared to isoform 1.
  • siRNA

    GAAAUUACCCUAAGUUAUAtt

    GGAUAAAAGCAAGACUCUAtt

    CAUUUGCAUCGAUACUAAAtt

    CCAAGACUCUUCAUAGUUUtt

    GCUUCUACCUACGCAAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Nox4(NM_015760) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus NADPH oxidase 4 (Nox4), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1737
  • Annotation
    This variant (1) encodes the longest isoform (1).
  • siRNA

    GAAAUUACCCUAAGUUAUAtt

    GGAUAAAAGCAAGACUCUAtt

    CAUUUGCAUCGAUACUAAAtt

    CCAAGACUCUUCAUAGUUUtt

    GCUUCUACCUACGCAAUAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pUC19
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2686
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pUC19 is a small, high-copy number E. coli plasmid cloning vector, of which multiple cloning sites as shown below. The molecule is a small double-stranded circle, 2686 base pairs in length. pUC19 encodes the N-terminal fragment of b-galactosidase (lacZa), which allows for blue/white colony screening (i.e., a-complementation), as well as a pUC origin of replication.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"