Cart 2
  • KLRC1 Human  cDNA/ORF Clone

KLRC1 Human cDNA/ORF Clone

Cat.#: 713314-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 267.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    killer cell lectin like receptor C1
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    KLRC1
  • Gene Type
    protein coding
  • Also Known as
    NKG2; NKG2A; CD159A
  • Encoded Protein Alias
    NKG2-A/NKG2-B type II integral membrane protein; C-lectin type II protein; CD159 antigen-like family member A; NK cell receptor A; NKG2-1/B activating NK receptor; NKG2-A/B type II integral membrane protein; NKG2-A/B-activating NK receptor; natural killer cell lectin; natural killer group protein 2
  • Product Name
    KLRC1(NM_001304448) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens killer cell lectin like receptor C1 (KLRC1), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    687
  • Annotation
    This variant (5) has alternate 5' and 3' terminal sequences, compared to variant 1. The resulting isoform (C) is C-terminal truncated, compared to isoform NKG2-A.
  • siRNA

    CCAUUUUAGCAACUGAACAtt

    CUAUCACUGCAAAGAUUUAtt

    GAUUUUCAAGGGAAUGACAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"