NovoPro
Cart 2
  • Kcnd2 Rat  cDNA/ORF Clone

Kcnd2 Rat cDNA/ORF Clone

Cat.#: 746051-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 324.5 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    potassium voltage-gated channel subfamily D member 2
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Kcnd2
  • Gene Type
    protein coding
  • Also Known as
    RK5; Kv4.2; Shal1
  • Encoded Protein Alias
    potassium channel, voltage-gated Shal-related subfamily D, member 2; potassium voltage gated channel, Shal-related family, member 2; potassium voltage-gated channel, Shal-related subfamily, member 2; voltage-gated potassium channel subunit Kv4.2
  • Product Name
    Kcnd2(NM_031730) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus potassium voltage-gated channel subfamily D member 2 (Kcnd2), mRNA.
  • Synonyms
  • ORF length
    1893
  • siRNA

    CCAUAGCAGGGAAGAUUUUtt

    GGCCUUCGUUAGCAAAUCUtt

    CCACAGCAAUAAUUAGCAUtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"