Cart 2
  • IFT88 Human  cDNA/ORF Clone

IFT88 Human cDNA/ORF Clone

Cat.#: 711641-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 397.0 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    intraflagellar transport 88
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    IFT88
  • Gene Type
    protein coding
  • Also Known as
    DAF19; TG737; TTC10; hTg737; D13S1056E
  • Encoded Protein Alias
    intraflagellar transport protein 88 homolog; TPR repeat protein 10; intraflagellar transport 88 homolog; polaris homolog; probe hTg737 (polycystic kidney disease, autosomal recessive); recessive polycystic kidney disease protein Tg737 homolog; tetratricopeptide repeat domain 10; tetratricopeptide repeat protein 10
  • Product Name
    IFT88(XM_017020767) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens intraflagellar transport 88 (IFT88), transcript variant X17, mRNA.
  • Synonyms
  • ORF length
    2316
  • siRNA

    CUAUGAGUCAUAUAGGUAUtt

    CCAAGUGUCAAUAAGCAAAtt

    GGUAGCUAGUUGUUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    IFT88(NM_001318491) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens intraflagellar transport 88 (IFT88), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    2418
  • Annotation
    This variant (3) lacks multiple alternate exons in the 5' UTR and 5' coding region, compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (3) with a shorter N-terminus, compared to isoform 1.
  • siRNA

    CUAUGAGUCAUAUAGGUAUtt

    CCAAGUGUCAAUAAGCAAAtt

    GGUAGCUAGUUGUUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    IFT88(XM_017020773) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens intraflagellar transport 88 (IFT88), transcript variant X23, mRNA.
  • Synonyms
  • ORF length
    2202
  • siRNA

    CUAUGAGUCAUAUAGGUAUtt

    CCAAGUGUCAAUAAGCAAAtt

    GGUAGCUAGUUGUUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    IFT88(XM_017020760) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens intraflagellar transport 88 (IFT88), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    2400
  • siRNA

    GGCAGUUACUAGACCUAUAtt

    GACCUAUAGCUACUGGAUAtt

    CUAUGAGUCAUAUAGGUAUtt

    CCAAGUGUCAAUAAGCAAAtt

    GGUAGCUAGUUGUUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    IFT88(XM_017020766) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens intraflagellar transport 88 (IFT88), transcript variant X16, mRNA.
  • Synonyms
  • ORF length
    2331
  • siRNA

    CUAUGAGUCAUAUAGGUAUtt

    CCAAGUGUCAAUAAGCAAAtt

    GGUAGCUAGUUGUUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    IFT88(XM_017020775) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens intraflagellar transport 88 (IFT88), transcript variant X26, mRNA.
  • Synonyms
  • ORF length
    1464
  • siRNA

    GGCAGUUACUAGACCUAUAtt

    GACCUAUAGCUACUGGAUAtt

    CCAAGUGUCAAUAAGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    IFT88(XM_017020763) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens intraflagellar transport 88 (IFT88), transcript variant X12, mRNA.
  • Synonyms
  • ORF length
    2388
  • siRNA

    GGCAGUUACUAGACCUAUAtt

    GACCUAUAGCUACUGGAUAtt

    CUAUGAGUCAUAUAGGUAUtt

    CCAAGUGUCAAUAAGCAAAtt

    GGUAGCUAGUUGUUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    IFT88(XM_017020758) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens intraflagellar transport 88 (IFT88), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    2445
  • siRNA

    CUAUGAGUCAUAUAGGUAUtt

    CCAAGUGUCAAUAAGCAAAtt

    GGUAGCUAGUUGUUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    IFT88(XM_017020768) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens intraflagellar transport 88 (IFT88), transcript variant X18, mRNA.
  • Synonyms
  • ORF length
    2313
  • siRNA

    GGCAGUUACUAGACCUAUAtt

    GACCUAUAGCUACUGGAUAtt

    CUAUGAGUCAUAUAGGUAUtt

    CCAAGUGUCAAUAAGCAAAtt

    GGUAGCUAGUUGUUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    IFT88(XM_017020759) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens intraflagellar transport 88 (IFT88), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    2415
  • siRNA

    GGCAGUUACUAGACCUAUAtt

    GACCUAUAGCUACUGGAUAtt

    CUAUGAGUCAUAUAGGUAUtt

    CCAAGUGUCAAUAAGCAAAtt

    GGUAGCUAGUUGUUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    IFT88(XM_017020772) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens intraflagellar transport 88 (IFT88), transcript variant X22, mRNA.
  • Synonyms
  • ORF length
    2262
  • siRNA

    GGCAGUUACUAGACCUAUAtt

    GACCUAUAGCUACUGGAUAtt

    CUAUGAGUCAUAUAGGUAUtt

    CCAAGUGUCAAUAAGCAAAtt

    GGUAGCUAGUUGUUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    IFT88(XM_017020764) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens intraflagellar transport 88 (IFT88), transcript variant X13, mRNA.
  • Synonyms
  • ORF length
    2373
  • siRNA

    GGCAGUUACUAGACCUAUAtt

    GACCUAUAGCUACUGGAUAtt

    CUAUGAGUCAUAUAGGUAUtt

    CCAAGUGUCAAUAAGCAAAtt

    GGUAGCUAGUUGUUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    IFT88(XM_017020770) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens intraflagellar transport 88 (IFT88), transcript variant X20, mRNA.
  • Synonyms
  • ORF length
    2289
  • siRNA

    GGCAGUUACUAGACCUAUAtt

    GACCUAUAGCUACUGGAUAtt

    CUAUGAGUCAUAUAGGUAUtt

    CCAAGUGUCAAUAAGCAAAtt

    GGUAGCUAGUUGUUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    IFT88(XM_017020769) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens intraflagellar transport 88 (IFT88), transcript variant X19, mRNA.
  • Synonyms
  • ORF length
    2304
  • siRNA

    CUAUGAGUCAUAUAGGUAUtt

    CCAAGUGUCAAUAAGCAAAtt

    GGUAGCUAGUUGUUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    IFT88(XM_017020765) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens intraflagellar transport 88 (IFT88), transcript variant X14, mRNA.
  • Synonyms
  • ORF length
    2364
  • siRNA

    GGCAGUUACUAGACCUAUAtt

    GACCUAUAGCUACUGGAUAtt

    CUAUGAGUCAUAUAGGUAUtt

    CCAAGUGUCAAUAAGCAAAtt

    GGUAGCUAGUUGUUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    IFT88(XM_017020774) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens intraflagellar transport 88 (IFT88), transcript variant X25, mRNA.
  • Synonyms
  • ORF length
    1842
  • siRNA

    GGCAGUUACUAGACCUAUAtt

    GACCUAUAGCUACUGGAUAtt

    CUAUGAGUCAUAUAGGUAUtt

    CCAAGUGUCAAUAAGCAAAtt

    GGUAGCUAGUUGUUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    IFT88(NM_006531) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens intraflagellar transport 88 (IFT88), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2475
  • Annotation
    This variant (2) lacks multiple alternate exons in the 5' UTR and lacks a portion of the 5' coding region, compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (2) with a shorter N-terminus, compared to isoform 1.
  • siRNA

    GGCAGUUACUAGACCUAUAtt

    GACCUAUAGCUACUGGAUAtt

    CUAUGAGUCAUAUAGGUAUtt

    CCAAGUGUCAAUAAGCAAAtt

    GGUAGCUAGUUGUUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    IFT88(XM_017020762) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens intraflagellar transport 88 (IFT88), transcript variant X11, mRNA.
  • Synonyms
  • ORF length
    2391
  • siRNA

    GGCAGUUACUAGACCUAUAtt

    GACCUAUAGCUACUGGAUAtt

    CUAUGAGUCAUAUAGGUAUtt

    CCAAGUGUCAAUAAGCAAAtt

    GGUAGCUAGUUGUUUCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    IFT88(XM_017020776) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens intraflagellar transport 88 (IFT88), transcript variant X32, mRNA.
  • Synonyms
  • ORF length
    1143
  • siRNA

    GGCAGUUACUAGACCUAUAtt

    GACCUAUAGCUACUGGAUAtt

    CCAAGUGUCAAUAAGCAAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"