Cart 2
  • IL12RB1 Human  cDNA/ORF Clone

IL12RB1 Human cDNA/ORF Clone

Cat.#: 713245-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 257.6 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    interleukin 12 receptor subunit beta 1
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    IL12RB1
  • Gene Type
    protein coding
  • Also Known as
    CD212; IMD30; IL12RB; IL-12R-BETA1
  • Encoded Protein Alias
    interleukin-12 receptor subunit beta-1; IL-12 receptor beta component; IL-12 receptor subunit beta-1; IL-12R subunit beta-1; cluster of differentiation 212; interleukin-12 receptor beta-1 chain
  • Product Name
    IL12RB1(XM_011527970) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens interleukin 12 receptor subunit beta 1 (IL12RB1), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    2178
  • siRNA

    CUAGGGACCUGAGAUGCUAtt

    GCAGUAUGAGGGUCCCACAtt

    GGAUAUCCAGUGAUCGUUAtt

    CCUGAGAUGCUAUCGGAUAtt

    GCAGCUCUACAACUCAGUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    IL12RB1(XM_011527977) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens interleukin 12 receptor subunit beta 1 (IL12RB1), transcript variant X14, mRNA.
  • Synonyms
  • ORF length
    1266
  • siRNA

    CUAGGGACCUGAGAUGCUAtt

    GCAGUAUGAGGGUCCCACAtt

    GGAUAUCCAGUGAUCGUUAtt

    CCUGAGAUGCUAUCGGAUAtt

    GCAGCUCUACAACUCAGUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    IL12RB1(XM_011527966) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens interleukin 12 receptor subunit beta 1 (IL12RB1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2238
  • siRNA

    CUAGGGACCUGAGAUGCUAtt

    GCAGUAUGAGGGUCCCACAtt

    GGAUAUCCAGUGAUCGUUAtt

    CCUGAGAUGCUAUCGGAUAtt

    GCAGCUCUACAACUCAGUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    IL12RB1(XM_011527974) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens interleukin 12 receptor subunit beta 1 (IL12RB1), transcript variant X10, mRNA.
  • Synonyms
  • ORF length
    2106
  • siRNA

    CUAGGGACCUGAGAUGCUAtt

    GCAGUAUGAGGGUCCCACAtt

    GGAUAUCCAGUGAUCGUUAtt

    CCUGAGAUGCUAUCGGAUAtt

    GCAGCUCUACAACUCAGUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    IL12RB1(XM_011527968) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens interleukin 12 receptor subunit beta 1 (IL12RB1), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    2217
  • siRNA

    CUAGGGACCUGAGAUGCUAtt

    GCAGUAUGAGGGUCCCACAtt

    GGAUAUCCAGUGAUCGUUAtt

    CCUGAGAUGCUAUCGGAUAtt

    GCAGCUCUACAACUCAGUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    IL12RB1(NM_001290023) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens interleukin 12 receptor subunit beta 1 (IL12RB1), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1983
  • Annotation
    This variant (3) represents the use of an alternate promoter and has multiple differences compared to variant 4, one of which results in a translational frameshift. These differences result in distinct 5' and 3' UTRs and the use of a downstream start codon, causing the encoded isoform (3, also known as Short) to contain a shorter N-terminus and a distinct C-terminus compared to isoform 4.
  • siRNA

    CUAGGGACCUGAGAUGCUAtt

    GCAGUAUGAGGGUCCCACAtt

    GGAUAUCCAGUGAUCGUUAtt

    CCUGAGAUGCUAUCGGAUAtt

    GCAGCUCUACAACUCAGUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    IL12RB1(XM_011527972) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens interleukin 12 receptor subunit beta 1 (IL12RB1), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    2136
  • siRNA

    CUAGGGACCUGAGAUGCUAtt

    GCAGUAUGAGGGUCCCACAtt

    GGAUAUCCAGUGAUCGUUAtt

    CCUGAGAUGCUAUCGGAUAtt

    GCAGCUCUACAACUCAGUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    IL12RB1(NM_153701) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens interleukin 12 receptor subunit beta 1 (IL12RB1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1146
  • Annotation
    This variant (2) represents the use of an alternate promoter, differs in the 5' UTR and has a different 3' structure which results in a translational frameshift and an early stop codon compared to variant 4. The encoded isoform (2) has a shorter N-terminus and a distinct C-terminus compared to isoform 4.
  • siRNA

    CUAGGGACCUGAGAUGCUAtt

    GCAGUAUGAGGGUCCCACAtt

    GGAUAUCCAGUGAUCGUUAtt

    CCUGAGAUGCUAUCGGAUAtt

    GCAGCUCUACAACUCAGUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    IL12RB1(XM_011527971) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens interleukin 12 receptor subunit beta 1 (IL12RB1), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    2142
  • siRNA

    CUAGGGACCUGAGAUGCUAtt

    GCAGUAUGAGGGUCCCACAtt

    GGAUAUCCAGUGAUCGUUAtt

    CCUGAGAUGCUAUCGGAUAtt

    GCAGCUCUACAACUCAGUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    IL12RB1(XM_011527976) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens interleukin 12 receptor subunit beta 1 (IL12RB1), transcript variant X12, mRNA.
  • Synonyms
  • ORF length
    1806
  • siRNA

    CUAGGGACCUGAGAUGCUAtt

    GCAGUAUGAGGGUCCCACAtt

    GGAUAUCCAGUGAUCGUUAtt

    CCUGAGAUGCUAUCGGAUAtt

    GCAGCUCUACAACUCAGUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    IL12RB1(XM_006722741) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens interleukin 12 receptor subunit beta 1 (IL12RB1), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    2145
  • siRNA

    CUAGGGACCUGAGAUGCUAtt

    GCAGUAUGAGGGUCCCACAtt

    GGAUAUCCAGUGAUCGUUAtt

    CCUGAGAUGCUAUCGGAUAtt

    GCAGCUCUACAACUCAGUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    IL12RB1(XM_011527969) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens interleukin 12 receptor subunit beta 1 (IL12RB1), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    2205
  • siRNA

    CUAGGGACCUGAGAUGCUAtt

    GCAGUAUGAGGGUCCCACAtt

    GGAUAUCCAGUGAUCGUUAtt

    CCUGAGAUGCUAUCGGAUAtt

    GCAGCUCUACAACUCAGUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    IL12RB1(XM_011527975) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens interleukin 12 receptor subunit beta 1 (IL12RB1), transcript variant X11, mRNA.
  • Synonyms
  • ORF length
    2103
  • siRNA

    CUAGGGACCUGAGAUGCUAtt

    GCAGUAUGAGGGUCCCACAtt

    GGAUAUCCAGUGAUCGUUAtt

    CCUGAGAUGCUAUCGGAUAtt

    GCAGCUCUACAACUCAGUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    IL12RB1(XM_011527973) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens interleukin 12 receptor subunit beta 1 (IL12RB1), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    2118
  • siRNA

    CUAGGGACCUGAGAUGCUAtt

    GCAGUAUGAGGGUCCCACAtt

    GGAUAUCCAGUGAUCGUUAtt

    CCUGAGAUGCUAUCGGAUAtt

    GCAGCUCUACAACUCAGUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    IL12RB1(XM_011527967) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens interleukin 12 receptor subunit beta 1 (IL12RB1), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    2226
  • siRNA

    CUAGGGACCUGAGAUGCUAtt

    GCAGUAUGAGGGUCCCACAtt

    GGAUAUCCAGUGAUCGUUAtt

    CCUGAGAUGCUAUCGGAUAtt

    GCAGCUCUACAACUCAGUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    IL12RB1(NM_001290024) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens interleukin 12 receptor subunit beta 1 (IL12RB1), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    2109
  • Annotation
    This variant (4) encodes the longest isoform (4).
  • siRNA

    CUAGGGACCUGAGAUGCUAtt

    GCAGUAUGAGGGUCCCACAtt

    GGAUAUCCAGUGAUCGUUAtt

    CCUGAGAUGCUAUCGGAUAtt

    GCAGCUCUACAACUCAGUUtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-C-EGFP
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6703
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    GFPSpark
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-C-FLAG
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6013
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    FLAG
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-C-HA
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6016
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    HA
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-C-His
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6019
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    His
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-C-Myc
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6019
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    Myc
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-C-mOrange2
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6662
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    OFPSpark
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-SP-N-FLAG
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6058
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    FLAG
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pUC18c
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2693
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pMD18-T Vector is a high-efficiency TA cloning vector constructed from pUC18, of which the initial multiple cloning sites (MCS) were destroyed. Thus the cDNA should be amplified by PCR with primers containing a restriction site for subclone. Competent cells appropriate for pUC18 are also appropriated for this Vector, e.g. JM109, DH5α, TOP10. The pMD18-T Simple Vector is 2.6kb in size. Selection of the plasmid in E. coli is conferred by the ampicillin resistance gene. The coding sequence was inserted by TA cloning at site 425.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"