Cart 2
  • ITGAX Human  cDNA/ORF Clone

ITGAX Human cDNA/ORF Clone

Cat.#: 713347-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 316.2 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    integrin subunit alpha X
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    ITGAX
  • Gene Type
    protein coding
  • Also Known as
    CD11C; SLEB6
  • Encoded Protein Alias
    integrin alpha-X; CD11 antigen-like family member C; integrin, alpha X (antigen CD11C (p150), alpha polypeptide); leu M5, alpha subunit; leukocyte adhesion glycoprotein p150,95 alpha chain; leukocyte adhesion receptor p150,95; leukocyte surface antigen p150,95, alpha subunit; myeloid membrane antigen, alpha subunit; p150 95 integrin alpha chain
  • Product Name
    ITGAX(NM_000887) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens integrin subunit alpha X (ITGAX), transcript variant 2, mRNA.
  • Synonyms
    XM_937997  
  • ORF length
    3492
  • Annotation
    This variant (2) lacks an alternate intron in the 3' coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1.
  • siRNA

    UCAUCACAGCGGUACUGUAtt

    AGUCCAACAUCUGCCUUUAtt

    ACAGAUACCAGGUCAAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ITGAX(NM_001286375) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens integrin subunit alpha X (ITGAX), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    3510
  • Annotation
    This variant (1) encodes the longer isoform (1).
  • siRNA

    UCAUCACAGCGGUACUGUAtt

    AGUCCAACAUCUGCCUUUAtt

    ACAGAUACCAGGUCAAUAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pUC18c
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2693
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pMD18-T Vector is a high-efficiency TA cloning vector constructed from pUC18, of which the initial multiple cloning sites (MCS) were destroyed. Thus the cDNA should be amplified by PCR with primers containing a restriction site for subclone. Competent cells appropriate for pUC18 are also appropriated for this Vector, e.g. JM109, DH5α, TOP10. The pMD18-T Simple Vector is 2.6kb in size. Selection of the plasmid in E. coli is conferred by the ampicillin resistance gene. The coding sequence was inserted by TA cloning at site 425.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"