Cart 2
  • INPP5K Human  cDNA/ORF Clone

INPP5K Human cDNA/ORF Clone

Cat.#: 707004-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 271.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    inositol polyphosphate-5-phosphatase K
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    INPP5K
  • Gene Type
    protein coding
  • Also Known as
    PPS; SKIP
  • Encoded Protein Alias
    inositol polyphosphate 5-phosphatase K; skeletal muscle and kidney-enriched inositol phosphatase
  • Product Name
    INPP5K(NM_130766) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens inositol polyphosphate-5-phosphatase K (INPP5K), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1119
  • Annotation
    This variant (3) has an additional segment in its 5' end, as compared to variant 1. The resulting isoform, isoform 2, has a shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same isoform, isoform 2.
  • siRNA

    CGACCUCAUUAUCUGGUUUtt

    CCUCAAUCUUGACAUAUAUtt

    CAAUAUCCCUACCACUGAAtt

    GAACCUCAAUCUUGACAUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pOTB7
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    1815
  • Vector Type
    Cloning Vector
  • Promoter
    -
  • Antibiotic Resistance
    Chloramphenicol
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Gateway® or compatible clone with M13 forward and M13 reverse primers. Chloramphenicol resistance in bacteria.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5494
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"